Multiple sequence alignment - TraesCS7A01G020000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7A01G020000 chr7A 100.000 1350 0 0 990 2339 8174528 8175877 0.000000e+00 2494
1 TraesCS7A01G020000 chr7A 98.668 1351 16 2 990 2339 8053888 8055237 0.000000e+00 2394
2 TraesCS7A01G020000 chr7A 97.183 710 13 3 991 1699 8217117 8217820 0.000000e+00 1194
3 TraesCS7A01G020000 chr7A 100.000 638 0 0 1 638 8173539 8174176 0.000000e+00 1179
4 TraesCS7A01G020000 chr7A 97.731 617 10 2 2 618 8052854 8053466 0.000000e+00 1059
5 TraesCS7A01G020000 chr7A 95.426 634 27 2 1 634 8216065 8216696 0.000000e+00 1009
6 TraesCS7A01G020000 chr7A 94.299 649 25 3 1 638 7963807 7964454 0.000000e+00 983
7 TraesCS7A01G020000 chr7A 96.398 583 20 1 1696 2277 8217783 8218365 0.000000e+00 959
8 TraesCS7A01G020000 chr7A 96.825 252 8 0 387 638 8103255 8103506 2.780000e-114 422
9 TraesCS7A01G020000 chr7A 88.073 327 31 5 1 326 156128117 156128436 4.720000e-102 381
10 TraesCS7A01G020000 chr3D 96.718 579 19 0 1699 2277 327463333 327462755 0.000000e+00 965
11 TraesCS7A01G020000 chr3D 94.964 278 12 2 1425 1700 327463575 327463298 3.570000e-118 435
12 TraesCS7A01G020000 chr3D 96.970 66 2 0 2274 2339 250065818 250065753 6.830000e-21 111
13 TraesCS7A01G020000 chr6D 96.200 579 22 0 1699 2277 71360276 71359698 0.000000e+00 948
14 TraesCS7A01G020000 chr6D 95.200 375 18 0 990 1364 338920660 338921034 5.570000e-166 593
15 TraesCS7A01G020000 chr6D 95.238 273 11 2 1429 1700 328837298 328837569 4.620000e-117 431
16 TraesCS7A01G020000 chr6D 95.131 267 12 1 1435 1700 71360507 71360241 1.000000e-113 420
17 TraesCS7A01G020000 chr7D 96.028 579 20 1 1699 2277 32385851 32385276 0.000000e+00 939
18 TraesCS7A01G020000 chr7D 89.619 578 56 4 1699 2274 602782945 602783520 0.000000e+00 732
19 TraesCS7A01G020000 chr7D 95.455 264 11 1 1438 1700 32386079 32385816 1.000000e-113 420
20 TraesCS7A01G020000 chr7D 95.131 267 12 1 1435 1700 530557115 530556849 1.000000e-113 420
21 TraesCS7A01G020000 chr7D 86.562 320 34 5 8 321 412151062 412150746 6.190000e-91 344
22 TraesCS7A01G020000 chr7D 86.164 318 35 6 10 321 28335392 28335078 3.720000e-88 335
23 TraesCS7A01G020000 chr7D 86.230 305 25 10 316 612 7216208 7216503 4.850000e-82 315
24 TraesCS7A01G020000 chr7D 90.741 216 13 5 402 612 7197996 7198209 4.920000e-72 281
25 TraesCS7A01G020000 chrUn 95.855 579 21 1 1699 2277 185729031 185728456 0.000000e+00 933
26 TraesCS7A01G020000 chrUn 95.833 264 10 1 1438 1700 185729259 185728996 2.150000e-115 425
27 TraesCS7A01G020000 chrUn 96.923 65 2 0 2275 2339 20512419 20512483 2.460000e-20 110
28 TraesCS7A01G020000 chr3A 88.144 582 62 5 1700 2277 621921441 621920863 0.000000e+00 686
29 TraesCS7A01G020000 chr3A 87.629 582 63 5 1700 2277 590371091 590370515 0.000000e+00 667
30 TraesCS7A01G020000 chr3A 96.970 66 2 0 2274 2339 353466222 353466157 6.830000e-21 111
31 TraesCS7A01G020000 chr2B 95.722 374 16 0 991 1364 793363955 793364328 9.250000e-169 603
32 TraesCS7A01G020000 chr4A 95.467 375 16 1 990 1363 683420727 683421101 4.300000e-167 597
33 TraesCS7A01G020000 chr4A 89.568 278 25 3 320 593 732904118 732903841 1.330000e-92 350
34 TraesCS7A01G020000 chr4A 87.857 280 29 4 316 590 732486810 732487089 8.060000e-85 324
35 TraesCS7A01G020000 chr4A 100.000 61 0 0 2279 2339 44581381 44581441 1.900000e-21 113
36 TraesCS7A01G020000 chr2D 95.442 373 17 0 991 1363 308681745 308681373 1.550000e-166 595
37 TraesCS7A01G020000 chr2D 95.174 373 18 0 991 1363 308678314 308677942 7.200000e-165 590
38 TraesCS7A01G020000 chr2D 89.028 319 33 2 7 324 4377884 4378201 6.060000e-106 394
39 TraesCS7A01G020000 chr2D 88.715 319 34 2 7 324 4321161 4321478 2.820000e-104 388
40 TraesCS7A01G020000 chr3B 95.200 375 18 0 991 1365 161677855 161677481 5.570000e-166 593
41 TraesCS7A01G020000 chr1B 95.187 374 18 0 991 1364 482481362 482481735 2.000000e-165 592
42 TraesCS7A01G020000 chr5D 90.476 315 23 4 8 322 543511024 543510717 2.160000e-110 409
43 TraesCS7A01G020000 chr2A 88.764 267 26 3 1435 1700 754020265 754020528 8.060000e-85 324
44 TraesCS7A01G020000 chr7B 100.000 61 0 0 2279 2339 137021045 137020985 1.900000e-21 113
45 TraesCS7A01G020000 chr1A 100.000 61 0 0 2279 2339 34188645 34188705 1.900000e-21 113
46 TraesCS7A01G020000 chr1A 97.015 67 2 0 2273 2339 129083881 129083947 1.900000e-21 113
47 TraesCS7A01G020000 chr5B 96.923 65 2 0 2275 2339 197417473 197417409 2.460000e-20 110


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7A01G020000 chr7A 8173539 8175877 2338 False 1836.5 2494 100.000000 1 2339 2 chr7A.!!$F5 2338
1 TraesCS7A01G020000 chr7A 8052854 8055237 2383 False 1726.5 2394 98.199500 2 2339 2 chr7A.!!$F4 2337
2 TraesCS7A01G020000 chr7A 8216065 8218365 2300 False 1054.0 1194 96.335667 1 2277 3 chr7A.!!$F6 2276
3 TraesCS7A01G020000 chr7A 7963807 7964454 647 False 983.0 983 94.299000 1 638 1 chr7A.!!$F1 637
4 TraesCS7A01G020000 chr3D 327462755 327463575 820 True 700.0 965 95.841000 1425 2277 2 chr3D.!!$R2 852
5 TraesCS7A01G020000 chr6D 71359698 71360507 809 True 684.0 948 95.665500 1435 2277 2 chr6D.!!$R1 842
6 TraesCS7A01G020000 chr7D 602782945 602783520 575 False 732.0 732 89.619000 1699 2274 1 chr7D.!!$F3 575
7 TraesCS7A01G020000 chr7D 32385276 32386079 803 True 679.5 939 95.741500 1438 2277 2 chr7D.!!$R4 839
8 TraesCS7A01G020000 chrUn 185728456 185729259 803 True 679.0 933 95.844000 1438 2277 2 chrUn.!!$R1 839
9 TraesCS7A01G020000 chr3A 621920863 621921441 578 True 686.0 686 88.144000 1700 2277 1 chr3A.!!$R3 577
10 TraesCS7A01G020000 chr3A 590370515 590371091 576 True 667.0 667 87.629000 1700 2277 1 chr3A.!!$R2 577
11 TraesCS7A01G020000 chr2D 308677942 308681745 3803 True 592.5 595 95.308000 991 1363 2 chr2D.!!$R1 372

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
354 367 0.770499 TGATGGTTGGCCTTGACTGA 59.23 50.0 3.32 0.0 35.27 3.41 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1604 3577 1.821216 GAAAGGGCCGATGAGAAACA 58.179 50.0 0.0 0.0 0.0 2.83 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
134 136 3.669290 CGAATTAATGCACTGTTTCGCCA 60.669 43.478 9.72 0.0 31.05 5.69
354 367 0.770499 TGATGGTTGGCCTTGACTGA 59.230 50.000 3.32 0.0 35.27 3.41
1604 3577 2.289547 CACATCGGTCACTTCGGTTTTT 59.710 45.455 0.00 0.0 0.00 1.94
1632 3605 2.547299 TCGGCCCTTTCGTCTTTTTA 57.453 45.000 0.00 0.0 0.00 1.52
1688 3661 1.212616 GAAATCGACGCTGGATGGAG 58.787 55.000 0.00 0.0 0.00 3.86
1986 4096 2.677003 CCGTGTTGGGCGTGATGTC 61.677 63.158 0.00 0.0 0.00 3.06
2221 5024 3.184581 GCCCGCAATTCTACTTATTCTCG 59.815 47.826 0.00 0.0 0.00 4.04
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
28 29 1.683917 GAATAAGGCGCTGAGAGAGGA 59.316 52.381 7.64 0.0 0.00 3.71
134 136 1.399089 CGGCGAACGGGACAAATATTT 59.601 47.619 0.00 0.0 39.42 1.40
271 273 1.060465 GCTCGAAAAATCGCCGTCC 59.940 57.895 0.00 0.0 0.00 4.79
354 367 7.117236 CGTACAGTACATGTGTTAAACCAAGAT 59.883 37.037 9.11 0.0 43.80 2.40
1245 1574 6.534079 GCCAATCAGAAATGAAGGAAAATCTG 59.466 38.462 4.78 0.0 36.50 2.90
1604 3577 1.821216 GAAAGGGCCGATGAGAAACA 58.179 50.000 0.00 0.0 0.00 2.83
1986 4096 3.643763 ACACTACTTTCTGCAACTCTCG 58.356 45.455 0.00 0.0 0.00 4.04
2221 5024 5.886960 ATTGCTCTGACTTTTATGACACC 57.113 39.130 0.00 0.0 0.00 4.16


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.