Multiple sequence alignment - TraesCS7A01G016800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7A01G016800 chr7A 100.000 3146 0 0 1 3146 7421832 7424977 0.000000e+00 5810
1 TraesCS7A01G016800 chr7A 97.928 2268 43 4 1 2267 46729833 46727569 0.000000e+00 3925
2 TraesCS7A01G016800 chr7A 98.144 1347 24 1 1 1346 194167192 194168538 0.000000e+00 2348
3 TraesCS7A01G016800 chr7A 86.018 329 34 8 2329 2649 680918614 680918290 3.000000e-90 342
4 TraesCS7A01G016800 chr3B 98.538 3147 44 2 1 3146 784063673 784060528 0.000000e+00 5555
5 TraesCS7A01G016800 chr4A 98.507 3148 43 4 1 3146 626535099 626531954 0.000000e+00 5550
6 TraesCS7A01G016800 chr5B 98.094 3148 56 4 1 3146 457391274 457388129 0.000000e+00 5478
7 TraesCS7A01G016800 chr5B 97.281 2096 53 4 1 2094 493911230 493913323 0.000000e+00 3552
8 TraesCS7A01G016800 chr5B 98.691 1222 15 1 1926 3146 48320123 48321344 0.000000e+00 2167
9 TraesCS7A01G016800 chr1B 98.269 2426 39 3 1 2424 59040158 59042582 0.000000e+00 4244
10 TraesCS7A01G016800 chr1B 98.398 749 11 1 2399 3146 626237752 626237004 0.000000e+00 1315
11 TraesCS7A01G016800 chr1B 97.335 638 16 1 2509 3146 59042569 59043205 0.000000e+00 1083
12 TraesCS7A01G016800 chr5A 97.884 2268 44 3 1 2267 41484867 41482603 0.000000e+00 3919
13 TraesCS7A01G016800 chr7D 90.593 2275 175 30 1 2252 321476084 321478342 0.000000e+00 2979
14 TraesCS7A01G016800 chr7D 86.275 612 60 10 2424 3029 321478537 321479130 0.000000e+00 643
15 TraesCS7A01G016800 chr4B 98.017 1664 31 2 1484 3146 141440384 141438722 0.000000e+00 2889
16 TraesCS7A01G016800 chr4B 97.906 191 4 0 2956 3146 17271443 17271253 6.500000e-87 331
17 TraesCS7A01G016800 chr5D 97.157 1020 24 4 2128 3146 500933949 500934964 0.000000e+00 1718
18 TraesCS7A01G016800 chr7B 83.410 217 23 7 2329 2537 664083192 664082981 4.140000e-44 189


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7A01G016800 chr7A 7421832 7424977 3145 False 5810.0 5810 100.000 1 3146 1 chr7A.!!$F1 3145
1 TraesCS7A01G016800 chr7A 46727569 46729833 2264 True 3925.0 3925 97.928 1 2267 1 chr7A.!!$R1 2266
2 TraesCS7A01G016800 chr7A 194167192 194168538 1346 False 2348.0 2348 98.144 1 1346 1 chr7A.!!$F2 1345
3 TraesCS7A01G016800 chr3B 784060528 784063673 3145 True 5555.0 5555 98.538 1 3146 1 chr3B.!!$R1 3145
4 TraesCS7A01G016800 chr4A 626531954 626535099 3145 True 5550.0 5550 98.507 1 3146 1 chr4A.!!$R1 3145
5 TraesCS7A01G016800 chr5B 457388129 457391274 3145 True 5478.0 5478 98.094 1 3146 1 chr5B.!!$R1 3145
6 TraesCS7A01G016800 chr5B 493911230 493913323 2093 False 3552.0 3552 97.281 1 2094 1 chr5B.!!$F2 2093
7 TraesCS7A01G016800 chr5B 48320123 48321344 1221 False 2167.0 2167 98.691 1926 3146 1 chr5B.!!$F1 1220
8 TraesCS7A01G016800 chr1B 59040158 59043205 3047 False 2663.5 4244 97.802 1 3146 2 chr1B.!!$F1 3145
9 TraesCS7A01G016800 chr1B 626237004 626237752 748 True 1315.0 1315 98.398 2399 3146 1 chr1B.!!$R1 747
10 TraesCS7A01G016800 chr5A 41482603 41484867 2264 True 3919.0 3919 97.884 1 2267 1 chr5A.!!$R1 2266
11 TraesCS7A01G016800 chr7D 321476084 321479130 3046 False 1811.0 2979 88.434 1 3029 2 chr7D.!!$F1 3028
12 TraesCS7A01G016800 chr4B 141438722 141440384 1662 True 2889.0 2889 98.017 1484 3146 1 chr4B.!!$R2 1662
13 TraesCS7A01G016800 chr5D 500933949 500934964 1015 False 1718.0 1718 97.157 2128 3146 1 chr5D.!!$F1 1018

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
248 249 0.752054 ACCGTGGAGTTCGTTACCAA 59.248 50.0 0.00 0.00 35.4 3.67 F
1820 1860 1.002366 CATCTGTACAGCGGCTTGAC 58.998 55.0 18.45 1.49 0.0 3.18 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2075 2115 1.485480 GGTACTTACAAGGAGGAGGCC 59.515 57.143 0.0 0.0 0.00 5.19 R
3044 3188 6.530534 GCACAGACTTTCTAATACACACGTAT 59.469 38.462 0.0 0.0 40.15 3.06 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
248 249 0.752054 ACCGTGGAGTTCGTTACCAA 59.248 50.000 0.00 0.00 35.40 3.67
344 345 3.484407 ACGGAACCATATAGAGCGTACT 58.516 45.455 0.00 0.00 0.00 2.73
391 392 5.764131 TCCTATTTTAAAAGTTGGCACACG 58.236 37.500 6.79 0.00 39.29 4.49
1514 1554 1.815003 CAAGGAAGACATTGCCTCACC 59.185 52.381 0.00 0.00 31.38 4.02
1766 1806 4.853196 CCACAAATAAGTGAATCAAGTGCG 59.147 41.667 0.00 0.00 42.05 5.34
1820 1860 1.002366 CATCTGTACAGCGGCTTGAC 58.998 55.000 18.45 1.49 0.00 3.18
1872 1912 5.874093 AGAAAGATCAAGCTTCCAAGAAGA 58.126 37.500 8.50 0.00 0.00 2.87
1873 1913 6.302269 AGAAAGATCAAGCTTCCAAGAAGAA 58.698 36.000 8.50 0.00 0.00 2.52
1954 1994 1.134098 ACATGGATGATGTTCCCGACC 60.134 52.381 0.00 0.00 43.20 4.79
2075 2115 4.344448 GAAGTCGACAAGATTAGTCCTCG 58.656 47.826 19.50 0.00 32.41 4.63
2124 2164 5.829924 TCTTGGTTTTCTGCATTTCTTCTCT 59.170 36.000 0.00 0.00 0.00 3.10
2489 2626 5.649557 TGTTTATATTGCTGCCATGTTGTC 58.350 37.500 0.00 0.00 0.00 3.18
2759 2899 6.140786 CGAGTCCATGAAGCAATCAATAATG 58.859 40.000 0.00 0.00 42.54 1.90
3044 3188 6.304356 CAGTCTGTGCTGTTGAAAATTCTA 57.696 37.500 0.00 0.00 0.00 2.10
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
118 119 5.541845 CAGATTTCAATACTCCGGCATCTA 58.458 41.667 0.00 0.00 0.00 1.98
248 249 5.731591 CCACCTCTACCGAAATCTTTTAGT 58.268 41.667 0.00 0.00 0.00 2.24
344 345 6.707440 AATCGCATTTTCCATACACCAATA 57.293 33.333 0.00 0.00 0.00 1.90
391 392 4.819630 TGACTTGAGTGTCAATTGGGTAAC 59.180 41.667 5.42 0.00 43.08 2.50
416 417 1.072159 AGCTGCCGCCATAGGAATC 59.928 57.895 0.00 0.00 36.60 2.52
1514 1554 1.661341 CAATCGGAGGCTTCCTTGAG 58.339 55.000 13.69 0.00 41.67 3.02
1820 1860 4.067192 TCACATAAGCCATCATGGAATCG 58.933 43.478 8.30 0.00 40.96 3.34
1954 1994 3.822735 TCAGAGGCAAAGATTTTGACCTG 59.177 43.478 16.61 15.51 31.37 4.00
2075 2115 1.485480 GGTACTTACAAGGAGGAGGCC 59.515 57.143 0.00 0.00 0.00 5.19
2124 2164 7.686434 AGCCTTACAAACTTATCTTTAGTGGA 58.314 34.615 0.00 0.00 0.00 4.02
2759 2899 9.651718 CGCTTAGACATAAAATATTTCAGGAAC 57.348 33.333 0.10 0.00 0.00 3.62
3044 3188 6.530534 GCACAGACTTTCTAATACACACGTAT 59.469 38.462 0.00 0.00 40.15 3.06


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.