Multiple sequence alignment - TraesCS7A01G013600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7A01G013600 chr7A 100.000 3005 0 0 1 3005 6275854 6278858 0.000000e+00 5550.0
1 TraesCS7A01G013600 chr7A 99.168 3005 19 1 1 3005 6216412 6219410 0.000000e+00 5406.0
2 TraesCS7A01G013600 chr7A 96.562 2065 56 7 1 2051 5598703 5600766 0.000000e+00 3406.0
3 TraesCS7A01G013600 chr7A 88.445 1177 119 8 886 2058 5362578 5363741 0.000000e+00 1404.0
4 TraesCS7A01G013600 chr7A 80.933 1201 192 28 874 2053 5768718 5769902 0.000000e+00 915.0
5 TraesCS7A01G013600 chr7A 80.944 1186 197 23 881 2053 5367120 5365951 0.000000e+00 911.0
6 TraesCS7A01G013600 chr7A 78.683 1093 198 16 923 2001 5430058 5428987 0.000000e+00 695.0
7 TraesCS7A01G013600 chr7A 95.434 219 8 1 2740 2958 6145225 6145441 6.170000e-92 348.0
8 TraesCS7A01G013600 chr7A 94.521 219 10 1 2740 2958 6223984 6224200 1.330000e-88 337.0
9 TraesCS7A01G013600 chr7A 90.083 121 10 2 2068 2186 5363790 5363910 4.010000e-34 156.0
10 TraesCS7A01G013600 chrUn 99.469 1507 8 0 1364 2870 334640591 334642097 0.000000e+00 2739.0
11 TraesCS7A01G013600 chrUn 81.099 1201 189 29 874 2053 228693908 228695091 0.000000e+00 926.0
12 TraesCS7A01G013600 chrUn 81.052 1198 190 28 877 2053 396821021 396819840 0.000000e+00 920.0
13 TraesCS7A01G013600 chrUn 80.952 1197 192 28 877 2053 396899586 396898406 0.000000e+00 915.0
14 TraesCS7A01G013600 chr4A 91.005 1990 111 30 92 2051 737870188 737868237 0.000000e+00 2621.0
15 TraesCS7A01G013600 chr4A 90.476 2016 121 28 76 2051 738051936 738053920 0.000000e+00 2593.0
16 TraesCS7A01G013600 chr4A 80.019 1026 186 11 940 1953 738710783 738711801 0.000000e+00 741.0
17 TraesCS7A01G013600 chr4A 77.706 1081 181 36 959 2001 737829313 737828255 9.210000e-170 606.0
18 TraesCS7A01G013600 chr7D 91.675 1910 116 13 162 2042 5016637 5018532 0.000000e+00 2606.0
19 TraesCS7A01G013600 chr7D 78.804 184 30 6 2496 2676 5021435 5021612 6.810000e-22 115.0
20 TraesCS7A01G013600 chr5B 84.000 150 16 7 2200 2341 429781027 429781176 1.450000e-28 137.0
21 TraesCS7A01G013600 chr5B 81.761 159 20 4 2191 2341 663233006 663233163 1.130000e-24 124.0
22 TraesCS7A01G013600 chr4D 82.692 156 24 1 2186 2341 7913952 7914104 5.230000e-28 135.0
23 TraesCS7A01G013600 chr4D 92.553 94 6 1 2253 2345 51917214 51917307 1.880000e-27 134.0
24 TraesCS7A01G013600 chr2A 94.318 88 4 1 2255 2341 406466097 406466184 1.880000e-27 134.0
25 TraesCS7A01G013600 chr2A 93.333 90 5 1 2253 2341 394743586 394743497 6.760000e-27 132.0
26 TraesCS7A01G013600 chr1B 82.119 151 19 7 2200 2342 482703596 482703746 4.070000e-24 122.0
27 TraesCS7A01G013600 chr6D 92.308 39 3 0 2955 2993 452527116 452527154 4.180000e-04 56.5


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7A01G013600 chr7A 6275854 6278858 3004 False 5550.0 5550 100.0000 1 3005 1 chr7A.!!$F6 3004
1 TraesCS7A01G013600 chr7A 6216412 6219410 2998 False 5406.0 5406 99.1680 1 3005 1 chr7A.!!$F4 3004
2 TraesCS7A01G013600 chr7A 5598703 5600766 2063 False 3406.0 3406 96.5620 1 2051 1 chr7A.!!$F1 2050
3 TraesCS7A01G013600 chr7A 5768718 5769902 1184 False 915.0 915 80.9330 874 2053 1 chr7A.!!$F2 1179
4 TraesCS7A01G013600 chr7A 5365951 5367120 1169 True 911.0 911 80.9440 881 2053 1 chr7A.!!$R1 1172
5 TraesCS7A01G013600 chr7A 5362578 5363910 1332 False 780.0 1404 89.2640 886 2186 2 chr7A.!!$F7 1300
6 TraesCS7A01G013600 chr7A 5428987 5430058 1071 True 695.0 695 78.6830 923 2001 1 chr7A.!!$R2 1078
7 TraesCS7A01G013600 chrUn 334640591 334642097 1506 False 2739.0 2739 99.4690 1364 2870 1 chrUn.!!$F2 1506
8 TraesCS7A01G013600 chrUn 228693908 228695091 1183 False 926.0 926 81.0990 874 2053 1 chrUn.!!$F1 1179
9 TraesCS7A01G013600 chrUn 396819840 396821021 1181 True 920.0 920 81.0520 877 2053 1 chrUn.!!$R1 1176
10 TraesCS7A01G013600 chrUn 396898406 396899586 1180 True 915.0 915 80.9520 877 2053 1 chrUn.!!$R2 1176
11 TraesCS7A01G013600 chr4A 737868237 737870188 1951 True 2621.0 2621 91.0050 92 2051 1 chr4A.!!$R2 1959
12 TraesCS7A01G013600 chr4A 738051936 738053920 1984 False 2593.0 2593 90.4760 76 2051 1 chr4A.!!$F1 1975
13 TraesCS7A01G013600 chr4A 738710783 738711801 1018 False 741.0 741 80.0190 940 1953 1 chr4A.!!$F2 1013
14 TraesCS7A01G013600 chr4A 737828255 737829313 1058 True 606.0 606 77.7060 959 2001 1 chr4A.!!$R1 1042
15 TraesCS7A01G013600 chr7D 5016637 5021612 4975 False 1360.5 2606 85.2395 162 2676 2 chr7D.!!$F1 2514

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1331 1383 4.385405 ACTGAGCTGGCCGCAGAC 62.385 66.667 19.3 11.52 43.18 3.51 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2807 5576 2.729194 TGAGGAGACAGAGAAGGCTAC 58.271 52.381 0.0 0.0 0.0 3.58 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1331 1383 4.385405 ACTGAGCTGGCCGCAGAC 62.385 66.667 19.30 11.52 43.18 3.51
2218 2688 2.555547 GCGCCTATGGGGTTGCATC 61.556 63.158 0.00 0.00 37.97 3.91
2277 2747 6.431543 TCGCCCAGTTTCTGTTAATTAATTGA 59.568 34.615 11.05 0.00 0.00 2.57
2390 2860 5.006455 CACATGCATCTACAGATTCACACTC 59.994 44.000 0.00 0.00 31.00 3.51
2800 5569 9.881773 AACCTTCTCTATCTCTATTTCTCTCAT 57.118 33.333 0.00 0.00 0.00 2.90
2807 5576 9.430623 TCTATCTCTATTTCTCTCATGTACTCG 57.569 37.037 0.00 0.00 0.00 4.18
2873 5642 2.102420 TCATCGAAGGATTGTACGCCAT 59.898 45.455 0.00 0.00 0.00 4.40
2875 5644 0.937304 CGAAGGATTGTACGCCATGG 59.063 55.000 7.63 7.63 0.00 3.66
2881 5650 2.210144 ATTGTACGCCATGGCAGGGT 62.210 55.000 34.93 25.97 42.06 4.34
2910 5679 5.924254 CCCGTCTCTCATAAATAAACGCATA 59.076 40.000 0.00 0.00 0.00 3.14
2976 5745 1.696336 CATGGTATACAGAGCCTGGCT 59.304 52.381 23.64 23.64 43.88 4.75
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
2218 2688 5.037385 CGATATGTGTACAACTCACAGAGG 58.963 45.833 0.0 0.0 46.54 3.69
2390 2860 5.909621 AACATCATTGAAGATCCAACAGG 57.090 39.130 0.0 0.0 0.00 4.00
2800 5569 3.008330 GACAGAGAAGGCTACGAGTACA 58.992 50.000 0.0 0.0 0.00 2.90
2807 5576 2.729194 TGAGGAGACAGAGAAGGCTAC 58.271 52.381 0.0 0.0 0.00 3.58
2881 5650 5.607939 TTATTTATGAGAGACGGGAAGCA 57.392 39.130 0.0 0.0 0.00 3.91
2976 5745 3.422796 GGTCGCTAGATGATAGGGAAGA 58.577 50.000 0.0 0.0 38.07 2.87


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.