Multiple sequence alignment - TraesCS7A01G011200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7A01G011200 chr7A 100.000 2723 0 0 1 2723 4961338 4964060 0.000000e+00 5029
1 TraesCS7A01G011200 chrUn 98.148 2754 15 4 1 2723 189394040 189396788 0.000000e+00 4771
2 TraesCS7A01G011200 chrUn 97.260 1679 16 2 1075 2723 171046355 171048033 0.000000e+00 2819
3 TraesCS7A01G011200 chrUn 96.777 1148 6 3 1607 2723 399420378 399419231 0.000000e+00 1886
4 TraesCS7A01G011200 chrUn 92.214 411 3 1 2342 2723 452446858 452446448 3.060000e-154 555
5 TraesCS7A01G011200 chr5B 99.043 2611 20 1 1 2611 679660398 679663003 0.000000e+00 4678
6 TraesCS7A01G011200 chr7D 98.967 2613 20 3 1 2611 203554845 203552238 0.000000e+00 4669
7 TraesCS7A01G011200 chr7B 98.928 2611 23 1 1 2611 743087700 743090305 0.000000e+00 4662
8 TraesCS7A01G011200 chr4D 98.928 2611 21 2 1 2611 123414383 123416986 0.000000e+00 4660
9 TraesCS7A01G011200 chr4D 97.020 1678 20 17 1075 2723 398044286 398042610 0.000000e+00 2795
10 TraesCS7A01G011200 chr5A 98.889 2611 24 1 1 2611 16601422 16598817 0.000000e+00 4656
11 TraesCS7A01G011200 chr5A 98.737 2612 27 2 1 2611 300074480 300077086 0.000000e+00 4636
12 TraesCS7A01G011200 chr5A 98.583 2612 35 2 1 2611 600278236 600275626 0.000000e+00 4617
13 TraesCS7A01G011200 chr6A 98.813 2611 26 2 1 2611 289130131 289132736 0.000000e+00 4645
14 TraesCS7A01G011200 chr1D 96.984 2752 48 3 1 2723 185770956 185773701 0.000000e+00 4590
15 TraesCS7A01G011200 chr3D 94.386 1051 26 22 1703 2723 289179974 289178927 0.000000e+00 1583
16 TraesCS7A01G011200 chr6D 91.991 462 7 9 2291 2723 168759734 168760194 2.980000e-174 621
17 TraesCS7A01G011200 chr5D 91.558 462 9 2 2291 2723 301070572 301070112 6.450000e-171 610


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7A01G011200 chr7A 4961338 4964060 2722 False 5029 5029 100.000 1 2723 1 chr7A.!!$F1 2722
1 TraesCS7A01G011200 chrUn 189394040 189396788 2748 False 4771 4771 98.148 1 2723 1 chrUn.!!$F2 2722
2 TraesCS7A01G011200 chrUn 171046355 171048033 1678 False 2819 2819 97.260 1075 2723 1 chrUn.!!$F1 1648
3 TraesCS7A01G011200 chrUn 399419231 399420378 1147 True 1886 1886 96.777 1607 2723 1 chrUn.!!$R1 1116
4 TraesCS7A01G011200 chr5B 679660398 679663003 2605 False 4678 4678 99.043 1 2611 1 chr5B.!!$F1 2610
5 TraesCS7A01G011200 chr7D 203552238 203554845 2607 True 4669 4669 98.967 1 2611 1 chr7D.!!$R1 2610
6 TraesCS7A01G011200 chr7B 743087700 743090305 2605 False 4662 4662 98.928 1 2611 1 chr7B.!!$F1 2610
7 TraesCS7A01G011200 chr4D 123414383 123416986 2603 False 4660 4660 98.928 1 2611 1 chr4D.!!$F1 2610
8 TraesCS7A01G011200 chr4D 398042610 398044286 1676 True 2795 2795 97.020 1075 2723 1 chr4D.!!$R1 1648
9 TraesCS7A01G011200 chr5A 16598817 16601422 2605 True 4656 4656 98.889 1 2611 1 chr5A.!!$R1 2610
10 TraesCS7A01G011200 chr5A 300074480 300077086 2606 False 4636 4636 98.737 1 2611 1 chr5A.!!$F1 2610
11 TraesCS7A01G011200 chr5A 600275626 600278236 2610 True 4617 4617 98.583 1 2611 1 chr5A.!!$R2 2610
12 TraesCS7A01G011200 chr6A 289130131 289132736 2605 False 4645 4645 98.813 1 2611 1 chr6A.!!$F1 2610
13 TraesCS7A01G011200 chr1D 185770956 185773701 2745 False 4590 4590 96.984 1 2723 1 chr1D.!!$F1 2722
14 TraesCS7A01G011200 chr3D 289178927 289179974 1047 True 1583 1583 94.386 1703 2723 1 chr3D.!!$R1 1020

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
468 469 2.1914 AGAAGATTGGGCTCTGCTACA 58.809 47.619 0.0 0.0 28.67 2.74 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2446 2454 1.417517 CCACATGCATGAGTAGGCCTA 59.582 52.381 32.75 8.91 31.29 3.93 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
130 131 5.600908 TGTTGTTGTATAGCGAAACCTTC 57.399 39.130 0.00 0.0 0.00 3.46
232 233 6.149142 GCCAAAGAAAACATAAATCCATTGCA 59.851 34.615 0.00 0.0 0.00 4.08
468 469 2.191400 AGAAGATTGGGCTCTGCTACA 58.809 47.619 0.00 0.0 28.67 2.74
1209 1211 9.946165 CGGATGAGTATAGTTATTTATATCGCA 57.054 33.333 0.00 0.0 0.00 5.10
1605 1608 8.352942 CCAATCTTGTCTAACTTTGCTAACTTT 58.647 33.333 0.00 0.0 0.00 2.66
2483 2491 0.320374 TGGCCAAGTACTCGACCAAG 59.680 55.000 0.61 0.0 0.00 3.61
2488 2496 1.272490 CAAGTACTCGACCAAGCCTCA 59.728 52.381 0.00 0.0 0.00 3.86
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
130 131 3.305608 GCTGAGAATGGTTTTGTCAAGGG 60.306 47.826 0.00 0.00 0.00 3.95
196 197 5.738909 TGTTTTCTTTGGCTTTTCCATTCA 58.261 33.333 0.00 0.00 46.04 2.57
232 233 6.166982 GCTGTAGAGTCACTGGTTTCTAATT 58.833 40.000 0.00 0.00 0.00 1.40
468 469 5.087323 TCTTTCCTAGTTGAGTGGATCTGT 58.913 41.667 0.00 0.00 0.00 3.41
1209 1211 6.206829 GGAACAAGGAACTGTTTATAGCTGTT 59.793 38.462 0.00 0.11 40.86 3.16
1330 1333 2.006415 CCCACATAGGCCTTCCCCA 61.006 63.158 12.58 0.00 35.39 4.96
1605 1608 3.053095 ACAAGATACGGGTAGAGAAGGGA 60.053 47.826 0.00 0.00 0.00 4.20
2446 2454 1.417517 CCACATGCATGAGTAGGCCTA 59.582 52.381 32.75 8.91 31.29 3.93
2483 2491 1.227497 CATCCCTTCGCTCTGAGGC 60.227 63.158 6.83 0.00 0.00 4.70
2488 2496 0.895530 TTCGTTCATCCCTTCGCTCT 59.104 50.000 0.00 0.00 0.00 4.09


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.