Multiple sequence alignment - TraesCS7A01G011100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7A01G011100 chr7A 100.000 2319 0 0 1 2319 4959838 4962156 0 4283
1 TraesCS7A01G011100 chr5A 99.009 2320 17 2 1 2319 300072979 300075293 0 4152
2 TraesCS7A01G011100 chr5A 98.577 2319 25 3 1 2319 16602919 16600609 0 4093
3 TraesCS7A01G011100 chrUn 98.966 2320 18 2 1 2319 189392539 189394853 0 4146
4 TraesCS7A01G011100 chr2A 98.922 2320 19 2 1 2319 618279956 618277642 0 4141
5 TraesCS7A01G011100 chr6A 98.793 2319 22 3 1 2319 289128632 289130944 0 4122
6 TraesCS7A01G011100 chr7D 98.750 2320 23 2 1 2319 626698490 626696176 0 4119
7 TraesCS7A01G011100 chr7D 98.663 2319 26 1 1 2319 203556345 203554032 0 4106
8 TraesCS7A01G011100 chr7B 98.750 2320 23 2 1 2319 743086199 743088513 0 4119
9 TraesCS7A01G011100 chr4A 98.706 2319 27 3 1 2319 67587531 67585216 0 4113


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7A01G011100 chr7A 4959838 4962156 2318 False 4283 4283 100.000 1 2319 1 chr7A.!!$F1 2318
1 TraesCS7A01G011100 chr5A 300072979 300075293 2314 False 4152 4152 99.009 1 2319 1 chr5A.!!$F1 2318
2 TraesCS7A01G011100 chr5A 16600609 16602919 2310 True 4093 4093 98.577 1 2319 1 chr5A.!!$R1 2318
3 TraesCS7A01G011100 chrUn 189392539 189394853 2314 False 4146 4146 98.966 1 2319 1 chrUn.!!$F1 2318
4 TraesCS7A01G011100 chr2A 618277642 618279956 2314 True 4141 4141 98.922 1 2319 1 chr2A.!!$R1 2318
5 TraesCS7A01G011100 chr6A 289128632 289130944 2312 False 4122 4122 98.793 1 2319 1 chr6A.!!$F1 2318
6 TraesCS7A01G011100 chr7D 626696176 626698490 2314 True 4119 4119 98.750 1 2319 1 chr7D.!!$R2 2318
7 TraesCS7A01G011100 chr7D 203554032 203556345 2313 True 4106 4106 98.663 1 2319 1 chr7D.!!$R1 2318
8 TraesCS7A01G011100 chr7B 743086199 743088513 2314 False 4119 4119 98.750 1 2319 1 chr7B.!!$F1 2318
9 TraesCS7A01G011100 chr4A 67585216 67587531 2315 True 4113 4113 98.706 1 2319 1 chr4A.!!$R1 2318

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
740 742 4.142469 ACGTGAAAAAGTGTTGCTTAGCTT 60.142 37.5 5.6 0.0 36.17 3.74 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1630 1641 3.305608 GCTGAGAATGGTTTTGTCAAGGG 60.306 47.826 0.0 0.0 0.0 3.95 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
493 495 5.200483 TCCTTTGCCGAAATAGGATGAAAT 58.800 37.500 0.0 0.0 32.00 2.17
740 742 4.142469 ACGTGAAAAAGTGTTGCTTAGCTT 60.142 37.500 5.6 0.0 36.17 3.74
1057 1060 2.571206 GAAAGCCACATTCGTTTCGTC 58.429 47.619 0.0 0.0 0.00 4.20
1575 1581 6.127054 ACAGAGAAAGATTACCGATTCATCCA 60.127 38.462 0.0 0.0 0.00 3.41
1576 1582 6.763135 CAGAGAAAGATTACCGATTCATCCAA 59.237 38.462 0.0 0.0 0.00 3.53
1577 1583 7.443575 CAGAGAAAGATTACCGATTCATCCAAT 59.556 37.037 0.0 0.0 0.00 3.16
1578 1584 7.659390 AGAGAAAGATTACCGATTCATCCAATC 59.341 37.037 0.0 0.0 38.06 2.67
1579 1585 6.712547 AGAAAGATTACCGATTCATCCAATCC 59.287 38.462 0.0 0.0 38.17 3.01
1630 1641 5.600908 TGTTGTTGTATAGCGAAACCTTC 57.399 39.130 0.0 0.0 0.00 3.46
1732 1743 6.149142 GCCAAAGAAAACATAAATCCATTGCA 59.851 34.615 0.0 0.0 0.00 4.08
1968 1979 2.191400 AGAAGATTGGGCTCTGCTACA 58.809 47.619 0.0 0.0 28.67 2.74
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
493 495 2.787473 AAGTTGAATCGGCTGATCCA 57.213 45.000 8.88 0.0 32.24 3.41
740 742 9.672673 CTTTCTCTTCCTTATTCCATTTCACTA 57.327 33.333 0.00 0.0 0.00 2.74
1057 1060 2.288457 ACATGACGTGTGACTTCCTCAG 60.288 50.000 0.00 0.0 40.28 3.35
1217 1223 5.358160 TGTGACACGAGAATAGATCACATCT 59.642 40.000 0.22 0.0 41.00 2.90
1575 1581 7.398047 TCACTTCTGATCAAATTGGATTGGATT 59.602 33.333 0.00 0.0 33.11 3.01
1576 1582 6.893554 TCACTTCTGATCAAATTGGATTGGAT 59.106 34.615 0.00 0.0 35.64 3.41
1577 1583 6.247676 TCACTTCTGATCAAATTGGATTGGA 58.752 36.000 0.00 0.0 0.00 3.53
1578 1584 6.152323 ACTCACTTCTGATCAAATTGGATTGG 59.848 38.462 0.00 0.0 0.00 3.16
1579 1585 7.154435 ACTCACTTCTGATCAAATTGGATTG 57.846 36.000 0.00 0.0 0.00 2.67
1630 1641 3.305608 GCTGAGAATGGTTTTGTCAAGGG 60.306 47.826 0.00 0.0 0.00 3.95
1696 1707 5.738909 TGTTTTCTTTGGCTTTTCCATTCA 58.261 33.333 0.00 0.0 46.04 2.57
1732 1743 6.166982 GCTGTAGAGTCACTGGTTTCTAATT 58.833 40.000 0.00 0.0 0.00 1.40
1968 1979 5.087323 TCTTTCCTAGTTGAGTGGATCTGT 58.913 41.667 0.00 0.0 0.00 3.41


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.