Multiple sequence alignment - TraesCS7A01G011000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7A01G011000 chr7A 100.000 2573 0 0 1 2573 4947178 4949750 0 4752
1 TraesCS7A01G011000 chr7A 96.644 1013 33 1 1562 2573 120916932 120915920 0 1681
2 TraesCS7A01G011000 chr7A 96.644 1013 33 1 1562 2573 671951776 671950764 0 1681
3 TraesCS7A01G011000 chr5A 98.284 1573 27 0 1 1573 667818447 667816875 0 2756
4 TraesCS7A01G011000 chr5A 97.203 1573 22 1 1 1573 614342675 614341125 0 2641
5 TraesCS7A01G011000 chr5A 96.940 1013 30 1 1562 2573 16614031 16613019 0 1698
6 TraesCS7A01G011000 chr5A 96.841 1013 31 1 1562 2573 300057756 300058768 0 1692
7 TraesCS7A01G011000 chr7B 96.940 1013 30 1 1562 2573 743075081 743076093 0 1698
8 TraesCS7A01G011000 chr7B 96.465 990 33 1 1 988 47132631 47133620 0 1633
9 TraesCS7A01G011000 chr7B 95.745 987 40 2 3 988 247412443 247413428 0 1589
10 TraesCS7A01G011000 chr7B 96.843 792 24 1 773 1564 531995705 531996495 0 1323
11 TraesCS7A01G011000 chr2A 96.940 1013 30 1 1562 2573 735181556 735182568 0 1698
12 TraesCS7A01G011000 chr6A 96.844 1014 30 2 1562 2573 289117560 289118573 0 1694
13 TraesCS7A01G011000 chr6A 96.230 1008 33 3 1 1004 79127605 79126599 0 1646
14 TraesCS7A01G011000 chr6A 96.574 788 26 1 773 1560 272161065 272160279 0 1304
15 TraesCS7A01G011000 chr3B 96.742 1013 32 1 1562 2573 201626745 201625733 0 1687
16 TraesCS7A01G011000 chr3B 96.450 986 34 1 3 988 669852082 669851098 0 1626
17 TraesCS7A01G011000 chr6B 96.548 1014 32 3 1563 2573 394498724 394499737 0 1676
18 TraesCS7A01G011000 chr6B 95.960 990 38 1 1 988 388242317 388241328 0 1605
19 TraesCS7A01G011000 chr6B 95.960 990 36 2 1 988 388300718 388299731 0 1604
20 TraesCS7A01G011000 chr6B 95.758 990 39 2 1 988 388183492 388182504 0 1592
21 TraesCS7A01G011000 chr6B 97.096 792 22 1 773 1564 388166218 388165428 0 1334
22 TraesCS7A01G011000 chr6B 97.096 792 22 1 773 1564 388358270 388357480 0 1334
23 TraesCS7A01G011000 chr4D 98.052 770 15 0 795 1564 398050710 398049941 0 1339
24 TraesCS7A01G011000 chr7D 97.795 771 16 1 795 1564 381946915 381946145 0 1328
25 TraesCS7A01G011000 chr2B 96.970 792 23 1 773 1564 751961035 751960245 0 1328
26 TraesCS7A01G011000 chr3A 96.338 792 28 1 773 1564 718993402 718992612 0 1301


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7A01G011000 chr7A 4947178 4949750 2572 False 4752 4752 100.000 1 2573 1 chr7A.!!$F1 2572
1 TraesCS7A01G011000 chr7A 120915920 120916932 1012 True 1681 1681 96.644 1562 2573 1 chr7A.!!$R1 1011
2 TraesCS7A01G011000 chr7A 671950764 671951776 1012 True 1681 1681 96.644 1562 2573 1 chr7A.!!$R2 1011
3 TraesCS7A01G011000 chr5A 667816875 667818447 1572 True 2756 2756 98.284 1 1573 1 chr5A.!!$R3 1572
4 TraesCS7A01G011000 chr5A 614341125 614342675 1550 True 2641 2641 97.203 1 1573 1 chr5A.!!$R2 1572
5 TraesCS7A01G011000 chr5A 16613019 16614031 1012 True 1698 1698 96.940 1562 2573 1 chr5A.!!$R1 1011
6 TraesCS7A01G011000 chr5A 300057756 300058768 1012 False 1692 1692 96.841 1562 2573 1 chr5A.!!$F1 1011
7 TraesCS7A01G011000 chr7B 743075081 743076093 1012 False 1698 1698 96.940 1562 2573 1 chr7B.!!$F4 1011
8 TraesCS7A01G011000 chr7B 47132631 47133620 989 False 1633 1633 96.465 1 988 1 chr7B.!!$F1 987
9 TraesCS7A01G011000 chr7B 247412443 247413428 985 False 1589 1589 95.745 3 988 1 chr7B.!!$F2 985
10 TraesCS7A01G011000 chr7B 531995705 531996495 790 False 1323 1323 96.843 773 1564 1 chr7B.!!$F3 791
11 TraesCS7A01G011000 chr2A 735181556 735182568 1012 False 1698 1698 96.940 1562 2573 1 chr2A.!!$F1 1011
12 TraesCS7A01G011000 chr6A 289117560 289118573 1013 False 1694 1694 96.844 1562 2573 1 chr6A.!!$F1 1011
13 TraesCS7A01G011000 chr6A 79126599 79127605 1006 True 1646 1646 96.230 1 1004 1 chr6A.!!$R1 1003
14 TraesCS7A01G011000 chr6A 272160279 272161065 786 True 1304 1304 96.574 773 1560 1 chr6A.!!$R2 787
15 TraesCS7A01G011000 chr3B 201625733 201626745 1012 True 1687 1687 96.742 1562 2573 1 chr3B.!!$R1 1011
16 TraesCS7A01G011000 chr3B 669851098 669852082 984 True 1626 1626 96.450 3 988 1 chr3B.!!$R2 985
17 TraesCS7A01G011000 chr6B 394498724 394499737 1013 False 1676 1676 96.548 1563 2573 1 chr6B.!!$F1 1010
18 TraesCS7A01G011000 chr6B 388241328 388242317 989 True 1605 1605 95.960 1 988 1 chr6B.!!$R3 987
19 TraesCS7A01G011000 chr6B 388299731 388300718 987 True 1604 1604 95.960 1 988 1 chr6B.!!$R4 987
20 TraesCS7A01G011000 chr6B 388182504 388183492 988 True 1592 1592 95.758 1 988 1 chr6B.!!$R2 987
21 TraesCS7A01G011000 chr6B 388165428 388166218 790 True 1334 1334 97.096 773 1564 1 chr6B.!!$R1 791
22 TraesCS7A01G011000 chr6B 388357480 388358270 790 True 1334 1334 97.096 773 1564 1 chr6B.!!$R5 791
23 TraesCS7A01G011000 chr4D 398049941 398050710 769 True 1339 1339 98.052 795 1564 1 chr4D.!!$R1 769
24 TraesCS7A01G011000 chr7D 381946145 381946915 770 True 1328 1328 97.795 795 1564 1 chr7D.!!$R1 769
25 TraesCS7A01G011000 chr2B 751960245 751961035 790 True 1328 1328 96.970 773 1564 1 chr2B.!!$R1 791
26 TraesCS7A01G011000 chr3A 718992612 718993402 790 True 1301 1301 96.338 773 1564 1 chr3A.!!$R1 791

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
859 866 3.405093 CTGCTCCCCGCCTAATGCA 62.405 63.158 0.0 0.0 41.33 3.96 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1884 1918 0.395173 ATCCGCCGGGCACTTATTTT 60.395 50.0 20.71 0.0 0.0 1.82 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
652 653 5.785940 GGATATAGGTGAGGTGGGACTTAAT 59.214 44.000 0.00 0.00 0.00 1.40
859 866 3.405093 CTGCTCCCCGCCTAATGCA 62.405 63.158 0.00 0.00 41.33 3.96
1424 1457 4.202567 ACTTCTAAATGCCACTTCTTCCCA 60.203 41.667 0.00 0.00 0.00 4.37
1621 1654 4.015872 TCTGGTTATGCGTTTTCCTCTT 57.984 40.909 0.00 0.00 0.00 2.85
1633 1666 5.805486 GCGTTTTCCTCTTCACTTTTCTTTT 59.195 36.000 0.00 0.00 0.00 2.27
1732 1765 1.417288 ACGCCAGGAGATGATGATCA 58.583 50.000 0.00 0.00 0.00 2.92
1734 1767 2.141517 CGCCAGGAGATGATGATCAAC 58.858 52.381 0.00 0.00 0.00 3.18
1760 1794 2.283676 GGGTGGGACGGAGAGACA 60.284 66.667 0.00 0.00 0.00 3.41
1884 1918 2.005370 ACGGTTCTTAGGTCCTGTCA 57.995 50.000 0.00 0.00 0.00 3.58
1890 1924 5.935789 CGGTTCTTAGGTCCTGTCAAAATAA 59.064 40.000 0.00 0.00 0.00 1.40
1893 1927 7.094762 GGTTCTTAGGTCCTGTCAAAATAAGTG 60.095 40.741 0.00 0.00 0.00 3.16
1986 2020 3.682292 AAATCGCCCAGGTCCTCGC 62.682 63.158 0.00 0.00 0.00 5.03
2003 2037 2.522060 GCGGATATGTCCAAGCGAG 58.478 57.895 9.40 0.00 45.37 5.03
2009 2043 0.546122 TATGTCCAAGCGAGGCCAAT 59.454 50.000 5.01 0.00 0.00 3.16
2015 2049 3.630312 GTCCAAGCGAGGCCAATATTTTA 59.370 43.478 5.01 0.00 0.00 1.52
2076 2110 0.028505 CAAATCTGCGATTGGGAGCG 59.971 55.000 4.87 0.00 37.81 5.03
2117 2151 6.365520 AGAAATTCACTGGTGTAGGTTTCTT 58.634 36.000 0.00 5.42 32.51 2.52
2379 2415 1.242444 CCTAGGTAGGAGGGAGGGAA 58.758 60.000 0.00 0.00 46.63 3.97
2434 2470 0.107848 CGCGTTGGATAGGAAAGGGT 60.108 55.000 0.00 0.00 0.00 4.34
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
652 653 4.225942 AGAGATGTTCCAGACAAGGCATTA 59.774 41.667 0.00 0.00 42.62 1.90
859 866 5.358725 TCACATAAGCATTGCACAATGATCT 59.641 36.000 23.92 11.46 45.49 2.75
1424 1457 1.982395 TCCTGAAGACGGATGCGGT 60.982 57.895 12.44 0.00 0.00 5.68
1633 1666 8.077386 GCCCGAACGATTCCATAAAATAAATAA 58.923 33.333 0.00 0.00 0.00 1.40
1639 1672 3.283751 TGCCCGAACGATTCCATAAAAT 58.716 40.909 0.00 0.00 0.00 1.82
1640 1673 2.680841 CTGCCCGAACGATTCCATAAAA 59.319 45.455 0.00 0.00 0.00 1.52
1654 1687 4.257654 TTGCCCGTTTCTGCCCGA 62.258 61.111 0.00 0.00 0.00 5.14
1742 1775 3.075641 GTCTCTCCGTCCCACCCC 61.076 72.222 0.00 0.00 0.00 4.95
1743 1776 2.283676 TGTCTCTCCGTCCCACCC 60.284 66.667 0.00 0.00 0.00 4.61
1744 1777 2.647158 GGTGTCTCTCCGTCCCACC 61.647 68.421 0.00 0.00 38.86 4.61
1760 1794 2.637872 TCAACTCCTCTTTTCCATCGGT 59.362 45.455 0.00 0.00 0.00 4.69
1875 1909 2.492088 GGGCACTTATTTTGACAGGACC 59.508 50.000 0.00 0.00 0.00 4.46
1884 1918 0.395173 ATCCGCCGGGCACTTATTTT 60.395 50.000 20.71 0.00 0.00 1.82
1987 2021 0.603975 GGCCTCGCTTGGACATATCC 60.604 60.000 0.00 0.00 46.48 2.59
2003 2037 7.979537 CCTTTTGTTACTCCTAAAATATTGGCC 59.020 37.037 0.00 0.00 0.00 5.36
2009 2043 7.463431 TGCTCCCTTTTGTTACTCCTAAAATA 58.537 34.615 0.00 0.00 0.00 1.40
2015 2049 2.553247 GCTGCTCCCTTTTGTTACTCCT 60.553 50.000 0.00 0.00 0.00 3.69
2076 2110 6.150474 TGAATTTCTTTTTCGTAGGTGATCCC 59.850 38.462 0.00 0.00 0.00 3.85
2117 2151 2.282180 GGGCCTCGGTTTCTGCAA 60.282 61.111 0.84 0.00 0.00 4.08
2379 2415 1.134220 TCGTCTGCAAAGTGGGAAAGT 60.134 47.619 0.00 0.00 0.00 2.66
2434 2470 6.387192 TCCTGATAAATGAACCTTCTCCAA 57.613 37.500 0.00 0.00 0.00 3.53


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.