Multiple sequence alignment - TraesCS7A01G006000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7A01G006000 chr7A 100.000 2237 0 0 1 2237 2869638 2871874 0.000000e+00 4132
1 TraesCS7A01G006000 chr7A 97.903 2194 42 2 48 2237 85879387 85877194 0.000000e+00 3794
2 TraesCS7A01G006000 chr7A 89.655 406 30 5 218 619 607605737 607606134 7.130000e-140 507
3 TraesCS7A01G006000 chr7A 98.438 64 1 0 1 64 85881945 85881882 1.820000e-21 113
4 TraesCS7A01G006000 chr6A 98.079 2239 41 2 1 2237 604391167 604393405 0.000000e+00 3895
5 TraesCS7A01G006000 chr6A 90.335 269 21 4 38 303 610962410 610962676 4.570000e-92 348
6 TraesCS7A01G006000 chr6A 90.335 269 21 4 38 303 610986891 610987157 4.570000e-92 348
7 TraesCS7A01G006000 chr6A 90.335 269 21 4 38 303 611012974 611013240 4.570000e-92 348
8 TraesCS7A01G006000 chr2A 98.036 2240 41 2 1 2237 756945981 756943742 0.000000e+00 3890
9 TraesCS7A01G006000 chr2A 94.475 1629 79 7 617 2237 305826240 305824615 0.000000e+00 2499
10 TraesCS7A01G006000 chr2A 90.706 269 20 4 38 303 374482836 374483102 9.830000e-94 353
11 TraesCS7A01G006000 chr4A 97.992 2241 41 2 1 2237 684407803 684410043 0.000000e+00 3886
12 TraesCS7A01G006000 chr3A 97.855 2238 46 2 1 2237 26422492 26420256 0.000000e+00 3866
13 TraesCS7A01G006000 chr3A 98.025 1114 20 2 1125 2237 716469591 716468479 0.000000e+00 1934
14 TraesCS7A01G006000 chr5B 95.071 1623 69 7 617 2231 411795409 411797028 0.000000e+00 2543
15 TraesCS7A01G006000 chr4B 93.112 1626 103 8 617 2237 256157989 256156368 0.000000e+00 2374
16 TraesCS7A01G006000 chr2D 92.755 980 54 4 617 1596 276943146 276944108 0.000000e+00 1400
17 TraesCS7A01G006000 chr2D 90.594 404 32 4 218 617 276940511 276940912 4.230000e-147 531
18 TraesCS7A01G006000 chr2B 96.203 316 10 1 306 619 244700936 244701251 1.180000e-142 516
19 TraesCS7A01G006000 chr2B 95.873 315 11 1 307 619 244773747 244773433 1.980000e-140 508


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7A01G006000 chr7A 2869638 2871874 2236 False 4132.0 4132 100.0000 1 2237 1 chr7A.!!$F1 2236
1 TraesCS7A01G006000 chr7A 85877194 85881945 4751 True 1953.5 3794 98.1705 1 2237 2 chr7A.!!$R1 2236
2 TraesCS7A01G006000 chr6A 604391167 604393405 2238 False 3895.0 3895 98.0790 1 2237 1 chr6A.!!$F1 2236
3 TraesCS7A01G006000 chr2A 756943742 756945981 2239 True 3890.0 3890 98.0360 1 2237 1 chr2A.!!$R2 2236
4 TraesCS7A01G006000 chr2A 305824615 305826240 1625 True 2499.0 2499 94.4750 617 2237 1 chr2A.!!$R1 1620
5 TraesCS7A01G006000 chr4A 684407803 684410043 2240 False 3886.0 3886 97.9920 1 2237 1 chr4A.!!$F1 2236
6 TraesCS7A01G006000 chr3A 26420256 26422492 2236 True 3866.0 3866 97.8550 1 2237 1 chr3A.!!$R1 2236
7 TraesCS7A01G006000 chr3A 716468479 716469591 1112 True 1934.0 1934 98.0250 1125 2237 1 chr3A.!!$R2 1112
8 TraesCS7A01G006000 chr5B 411795409 411797028 1619 False 2543.0 2543 95.0710 617 2231 1 chr5B.!!$F1 1614
9 TraesCS7A01G006000 chr4B 256156368 256157989 1621 True 2374.0 2374 93.1120 617 2237 1 chr4B.!!$R1 1620
10 TraesCS7A01G006000 chr2D 276940511 276944108 3597 False 965.5 1400 91.6745 218 1596 2 chr2D.!!$F1 1378

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
442 2958 0.685131 CCCTGAATTGGGCAGCATCA 60.685 55.0 0.0 0.0 40.84 3.07 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2063 6820 8.770438 ATGACAGAACATAAGAGAAGAAACTC 57.23 34.615 0.0 0.0 37.19 3.01 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
155 2667 4.253685 ACAGTATGATGTTCGTCCCAAAG 58.746 43.478 0.00 0.0 39.69 2.77
293 2805 5.997843 TCTTCATGGTGTGATCATCATCTT 58.002 37.500 0.00 0.0 42.73 2.40
442 2958 0.685131 CCCTGAATTGGGCAGCATCA 60.685 55.000 0.00 0.0 40.84 3.07
853 5603 2.291217 GGAGGAGAAAGGGTGCAGATTT 60.291 50.000 0.00 0.0 0.00 2.17
861 5611 5.649831 AGAAAGGGTGCAGATTTATGAAGAC 59.350 40.000 0.00 0.0 0.00 3.01
1004 5754 0.454600 GGTGATGTGGCTGCAATGAG 59.545 55.000 0.50 0.0 0.00 2.90
1149 5900 1.807142 GAAGAAGTCAAGGCTTTCCGG 59.193 52.381 0.00 0.0 37.47 5.14
1888 6645 9.176460 TCTGTATTATGTCTTGCATGATTTTGA 57.824 29.630 5.49 0.0 38.47 2.69
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
225 2737 9.479549 ACCAATGATCATACCAAAAGTATCTTT 57.520 29.630 9.04 0.00 39.79 2.52
416 2932 2.183409 CCCAATTCAGGGTCTTGCG 58.817 57.895 0.00 0.00 44.24 4.85
442 2958 7.570607 AGAGGATTAATCTACCTTGTCCTTCAT 59.429 37.037 14.95 0.00 34.91 2.57
853 5603 3.162666 ACACCTCCTCAACGTCTTCATA 58.837 45.455 0.00 0.00 0.00 2.15
861 5611 1.007336 GCACGTACACCTCCTCAACG 61.007 60.000 0.00 0.00 39.37 4.10
1004 5754 5.437946 CCCTTATTTCCAAGTACTTCTCCC 58.562 45.833 4.77 0.00 0.00 4.30
1149 5900 1.486211 TCTCGGGGATCTTGAAGACC 58.514 55.000 0.00 1.12 0.00 3.85
1888 6645 9.118300 CTTTCAGAATATGGTTTAGCATCTCTT 57.882 33.333 0.00 0.00 0.00 2.85
2063 6820 8.770438 ATGACAGAACATAAGAGAAGAAACTC 57.230 34.615 0.00 0.00 37.19 3.01


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.