Multiple sequence alignment - TraesCS6D01G404000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6D01G404000 chr6D 100.000 2264 0 0 1 2264 472011155 472013418 0.000000e+00 4181.0
1 TraesCS6D01G404000 chr6D 98.148 1620 23 3 645 2264 471961626 471963238 0.000000e+00 2819.0
2 TraesCS6D01G404000 chr6D 97.698 782 12 1 1 782 471960946 471961721 0.000000e+00 1339.0
3 TraesCS6D01G404000 chr6D 91.111 45 2 2 2048 2091 377214312 377214355 2.430000e-05 60.2
4 TraesCS6D01G404000 chr1D 83.750 2000 199 47 1 1956 414932247 414930330 0.000000e+00 1777.0
5 TraesCS6D01G404000 chr1D 92.958 852 57 2 920 1770 198509505 198510354 0.000000e+00 1238.0
6 TraesCS6D01G404000 chr1D 88.972 934 90 11 5 937 198508633 198509554 0.000000e+00 1142.0
7 TraesCS6D01G404000 chr6A 89.293 1046 90 19 926 1958 607999583 607998547 0.000000e+00 1291.0
8 TraesCS6D01G404000 chr6B 92.308 884 62 6 926 1806 702946565 702945685 0.000000e+00 1251.0
9 TraesCS6D01G404000 chr6B 88.325 1045 100 19 927 1958 702991524 702990489 0.000000e+00 1234.0
10 TraesCS6D01G404000 chr6B 87.460 941 80 19 1 940 703064810 703063907 0.000000e+00 1050.0
11 TraesCS6D01G404000 chr6B 92.479 718 50 3 1 717 702947385 702946671 0.000000e+00 1024.0
12 TraesCS6D01G404000 chr6B 91.444 748 57 4 1 742 703057918 703057172 0.000000e+00 1020.0
13 TraesCS6D01G404000 chr6B 91.310 748 58 4 1 742 703015761 703015015 0.000000e+00 1014.0
14 TraesCS6D01G404000 chr6B 91.043 748 60 4 1 742 703107428 703106682 0.000000e+00 1003.0
15 TraesCS6D01G404000 chr6B 90.775 748 62 4 1 742 703008909 703008163 0.000000e+00 992.0
16 TraesCS6D01G404000 chr6B 86.404 228 25 6 714 940 703015079 703014857 6.250000e-61 244.0
17 TraesCS6D01G404000 chr3D 92.857 854 58 2 920 1772 116062435 116063286 0.000000e+00 1236.0
18 TraesCS6D01G404000 chr3D 78.125 96 15 5 1863 1955 116072369 116072277 3.140000e-04 56.5
19 TraesCS6D01G404000 chr5D 92.571 848 59 3 926 1772 358005760 358004916 0.000000e+00 1214.0
20 TraesCS6D01G404000 chr1B 91.256 892 67 5 920 1809 449941814 449942696 0.000000e+00 1205.0
21 TraesCS6D01G404000 chr1B 88.034 936 86 12 5 937 449940951 449941863 0.000000e+00 1085.0
22 TraesCS6D01G404000 chr3B 91.506 883 61 5 920 1801 548880011 548880880 0.000000e+00 1203.0
23 TraesCS6D01G404000 chr3B 81.538 195 32 4 2071 2264 548884695 548884886 8.370000e-35 158.0
24 TraesCS6D01G404000 chr2D 89.530 936 89 7 5 940 78327631 78326705 0.000000e+00 1177.0
25 TraesCS6D01G404000 chr2B 88.404 940 91 12 5 932 215847199 215848132 0.000000e+00 1116.0
26 TraesCS6D01G404000 chr7D 85.352 908 95 27 263 1166 562280162 562281035 0.000000e+00 905.0
27 TraesCS6D01G404000 chr5B 97.059 34 0 1 2058 2091 89728974 89728942 3.140000e-04 56.5


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6D01G404000 chr6D 472011155 472013418 2263 False 4181.0 4181 100.0000 1 2264 1 chr6D.!!$F2 2263
1 TraesCS6D01G404000 chr6D 471960946 471963238 2292 False 2079.0 2819 97.9230 1 2264 2 chr6D.!!$F3 2263
2 TraesCS6D01G404000 chr1D 414930330 414932247 1917 True 1777.0 1777 83.7500 1 1956 1 chr1D.!!$R1 1955
3 TraesCS6D01G404000 chr1D 198508633 198510354 1721 False 1190.0 1238 90.9650 5 1770 2 chr1D.!!$F1 1765
4 TraesCS6D01G404000 chr6A 607998547 607999583 1036 True 1291.0 1291 89.2930 926 1958 1 chr6A.!!$R1 1032
5 TraesCS6D01G404000 chr6B 702990489 702991524 1035 True 1234.0 1234 88.3250 927 1958 1 chr6B.!!$R1 1031
6 TraesCS6D01G404000 chr6B 702945685 702947385 1700 True 1137.5 1251 92.3935 1 1806 2 chr6B.!!$R6 1805
7 TraesCS6D01G404000 chr6B 703063907 703064810 903 True 1050.0 1050 87.4600 1 940 1 chr6B.!!$R4 939
8 TraesCS6D01G404000 chr6B 703057172 703057918 746 True 1020.0 1020 91.4440 1 742 1 chr6B.!!$R3 741
9 TraesCS6D01G404000 chr6B 703106682 703107428 746 True 1003.0 1003 91.0430 1 742 1 chr6B.!!$R5 741
10 TraesCS6D01G404000 chr6B 703008163 703008909 746 True 992.0 992 90.7750 1 742 1 chr6B.!!$R2 741
11 TraesCS6D01G404000 chr6B 703014857 703015761 904 True 629.0 1014 88.8570 1 940 2 chr6B.!!$R7 939
12 TraesCS6D01G404000 chr3D 116062435 116063286 851 False 1236.0 1236 92.8570 920 1772 1 chr3D.!!$F1 852
13 TraesCS6D01G404000 chr5D 358004916 358005760 844 True 1214.0 1214 92.5710 926 1772 1 chr5D.!!$R1 846
14 TraesCS6D01G404000 chr1B 449940951 449942696 1745 False 1145.0 1205 89.6450 5 1809 2 chr1B.!!$F1 1804
15 TraesCS6D01G404000 chr3B 548880011 548884886 4875 False 680.5 1203 86.5220 920 2264 2 chr3B.!!$F1 1344
16 TraesCS6D01G404000 chr2D 78326705 78327631 926 True 1177.0 1177 89.5300 5 940 1 chr2D.!!$R1 935
17 TraesCS6D01G404000 chr2B 215847199 215848132 933 False 1116.0 1116 88.4040 5 932 1 chr2B.!!$F1 927
18 TraesCS6D01G404000 chr7D 562280162 562281035 873 False 905.0 905 85.3520 263 1166 1 chr7D.!!$F1 903

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
376 379 1.671328 GGCGCCTCAGTTTAATCCTTC 59.329 52.381 22.15 0.0 0.0 3.46 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1310 1425 0.253044 AGGCGGTGACTGCATACAAT 59.747 50.0 19.2 0.0 0.0 2.71 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
376 379 1.671328 GGCGCCTCAGTTTAATCCTTC 59.329 52.381 22.15 0.0 0.00 3.46
706 747 5.187967 GTGGAGGAAGGACAATTCTTAGAGA 59.812 44.000 0.00 0.0 0.00 3.10
961 1075 4.693283 TCGTCTCTTTACATTAGGCATGG 58.307 43.478 0.00 0.0 37.17 3.66
1219 1334 4.183223 TGCCCCAACTATGCTTATGATT 57.817 40.909 0.00 0.0 0.00 2.57
2110 5797 2.426651 GCGGTAGGCCTCTGTATCA 58.573 57.895 9.68 0.0 34.80 2.15
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
49 50 2.697229 TGCAACAACCAATCATGAACCA 59.303 40.909 0.00 0.00 0.00 3.67
376 379 1.747355 GCCATTGTGACTCATCAAGGG 59.253 52.381 15.17 15.17 44.81 3.95
706 747 1.920835 GTCCTTCCTCCACTGCCCT 60.921 63.158 0.00 0.00 0.00 5.19
1219 1334 1.837538 GCGTTAGTTGGAAGCGCACA 61.838 55.000 11.47 2.05 46.23 4.57
1310 1425 0.253044 AGGCGGTGACTGCATACAAT 59.747 50.000 19.20 0.00 0.00 2.71
1518 1634 1.065636 TCCTCCTCATGAGCAAGCTTG 60.066 52.381 22.44 22.44 39.98 4.01
2208 5895 1.274447 GGTAAGGTTGCACGTCCTACT 59.726 52.381 4.95 0.00 33.27 2.57


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.