Multiple sequence alignment - TraesCS6D01G403500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6D01G403500 chr6D 100.000 2231 0 0 1 2231 471730587 471732817 0.000000e+00 4120
1 TraesCS6D01G403500 chr6D 97.529 526 13 0 1706 2231 471703239 471703764 0.000000e+00 900
2 TraesCS6D01G403500 chrUn 98.073 2231 42 1 1 2231 81369962 81367733 0.000000e+00 3880
3 TraesCS6D01G403500 chrUn 97.670 2232 51 1 1 2231 81396507 81394276 0.000000e+00 3832
4 TraesCS6D01G403500 chrUn 97.408 2238 49 6 1 2231 81375609 81373374 0.000000e+00 3803
5 TraesCS6D01G403500 chrUn 89.956 2250 185 24 1 2231 75033918 75036145 0.000000e+00 2865
6 TraesCS6D01G403500 chrUn 96.962 1580 34 4 240 1807 387522423 387524000 0.000000e+00 2639
7 TraesCS6D01G403500 chrUn 90.309 1909 144 22 1 1886 326635476 326637366 0.000000e+00 2462
8 TraesCS6D01G403500 chrUn 97.163 423 12 0 1809 2231 425795771 425796193 0.000000e+00 715
9 TraesCS6D01G403500 chrUn 86.378 646 76 12 1592 2231 74887129 74887768 0.000000e+00 695
10 TraesCS6D01G403500 chrUn 86.458 480 56 9 1754 2231 74917970 74918442 3.280000e-143 518
11 TraesCS6D01G403500 chr6A 89.969 2253 181 25 1 2231 618045585 618043356 0.000000e+00 2867
12 TraesCS6D01G403500 chr6A 89.911 2250 184 25 1 2230 618017546 618015320 0.000000e+00 2857
13 TraesCS6D01G403500 chr6B 89.370 2239 218 18 1 2231 716542926 716545152 0.000000e+00 2798


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6D01G403500 chr6D 471730587 471732817 2230 False 4120.0 4120 100.0000 1 2231 1 chr6D.!!$F2 2230
1 TraesCS6D01G403500 chr6D 471703239 471703764 525 False 900.0 900 97.5290 1706 2231 1 chr6D.!!$F1 525
2 TraesCS6D01G403500 chrUn 81367733 81375609 7876 True 3841.5 3880 97.7405 1 2231 2 chrUn.!!$R2 2230
3 TraesCS6D01G403500 chrUn 81394276 81396507 2231 True 3832.0 3832 97.6700 1 2231 1 chrUn.!!$R1 2230
4 TraesCS6D01G403500 chrUn 75033918 75036145 2227 False 2865.0 2865 89.9560 1 2231 1 chrUn.!!$F3 2230
5 TraesCS6D01G403500 chrUn 387522423 387524000 1577 False 2639.0 2639 96.9620 240 1807 1 chrUn.!!$F5 1567
6 TraesCS6D01G403500 chrUn 326635476 326637366 1890 False 2462.0 2462 90.3090 1 1886 1 chrUn.!!$F4 1885
7 TraesCS6D01G403500 chrUn 74887129 74887768 639 False 695.0 695 86.3780 1592 2231 1 chrUn.!!$F1 639
8 TraesCS6D01G403500 chr6A 618043356 618045585 2229 True 2867.0 2867 89.9690 1 2231 1 chr6A.!!$R2 2230
9 TraesCS6D01G403500 chr6A 618015320 618017546 2226 True 2857.0 2857 89.9110 1 2230 1 chr6A.!!$R1 2229
10 TraesCS6D01G403500 chr6B 716542926 716545152 2226 False 2798.0 2798 89.3700 1 2231 1 chr6B.!!$F1 2230

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
505 511 0.88649 GGACAAGGAGGGCATATGCG 60.886 60.0 21.04 8.17 43.26 4.73 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1828 7522 1.08992 GTGTGCCATGATCAGTGGAC 58.91 55.0 21.4 16.39 39.12 4.02 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
183 184 9.797473 GTTGAAATTAATAACTTGAGCAAAAGC 57.203 29.630 0.00 0.00 0.00 3.51
422 428 4.031765 CGTTAATCTCGACAACAGTGGATG 59.968 45.833 0.00 0.00 0.00 3.51
505 511 0.886490 GGACAAGGAGGGCATATGCG 60.886 60.000 21.04 8.17 43.26 4.73
558 564 7.862741 AAATGCATGCATTGTTATAATCGAG 57.137 32.000 38.98 0.00 44.86 4.04
904 936 4.141981 ACAAAACACCATGCATGTTTCTCA 60.142 37.500 24.58 0.00 46.88 3.27
1321 6994 2.497675 AGGTGAGCGAGTGTGATATTGT 59.502 45.455 0.00 0.00 0.00 2.71
1360 7035 3.576861 TGCTATGTAGTCTATGTGGGCT 58.423 45.455 0.00 0.00 0.00 5.19
1532 7208 5.818136 ATTAGCACCATGTCATACACAAC 57.182 39.130 0.00 0.00 38.97 3.32
1948 7642 8.263640 AGATTACAATCTTACATGACAGAGCTT 58.736 33.333 0.00 0.00 42.96 3.74
2051 7745 7.175467 TGGACGTTAGAATTCACACTAGTAGAA 59.825 37.037 8.44 11.11 0.00 2.10
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
447 453 9.934190 TCGATGATAACAATGTATTCATTTGTG 57.066 29.630 10.87 4.62 41.66 3.33
458 464 7.552458 TTAAGCATGTCGATGATAACAATGT 57.448 32.000 0.00 0.00 0.00 2.71
558 564 3.560068 CCATTTGAGTAGGTTACGCCATC 59.440 47.826 0.00 0.00 40.61 3.51
1128 6801 3.948719 TCTTGTGGCGGTGGGGAC 61.949 66.667 0.00 0.00 0.00 4.46
1532 7208 6.602179 TCTTTCTGAAAACGCACATTGATAG 58.398 36.000 4.18 0.00 0.00 2.08
1788 7481 8.826710 CGTATGACATATTTCCTTTAGCTTTCA 58.173 33.333 0.00 0.00 0.00 2.69
1828 7522 1.089920 GTGTGCCATGATCAGTGGAC 58.910 55.000 21.40 16.39 39.12 4.02
2051 7745 4.083324 CGGCGCTATCACATTATTCCATTT 60.083 41.667 7.64 0.00 0.00 2.32
2176 7871 2.614779 CATCGGAGCGCAGATATGATT 58.385 47.619 11.47 0.00 0.00 2.57


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.