Multiple sequence alignment - TraesCS6D01G375400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6D01G375400 chr6D 100.000 2192 0 0 1 2192 458941353 458939162 0 4048
1 TraesCS6D01G375400 chr4D 98.359 2194 31 3 1 2191 123448986 123446795 0 3847
2 TraesCS6D01G375400 chr3A 97.903 2194 35 3 1 2191 495104760 495102575 0 3786
3 TraesCS6D01G375400 chr3B 97.858 2194 35 5 1 2191 92296732 92294548 0 3781
4 TraesCS6D01G375400 chr3B 97.584 2194 41 4 1 2191 6010766 6008582 0 3747
5 TraesCS6D01G375400 chr2B 97.812 2194 37 3 1 2191 234541160 234538975 0 3775
6 TraesCS6D01G375400 chr2B 97.501 1961 39 2 233 2191 234502228 234500276 0 3341
7 TraesCS6D01G375400 chr1A 97.721 2194 38 4 1 2191 278521194 278523378 0 3764
8 TraesCS6D01G375400 chr1B 97.675 2194 39 4 1 2191 619195331 619193147 0 3759
9 TraesCS6D01G375400 chr1B 94.763 1394 66 6 800 2189 348908985 348910375 0 2163
10 TraesCS6D01G375400 chrUn 97.584 2194 41 4 1 2191 217907668 217909852 0 3747
11 TraesCS6D01G375400 chr6A 98.137 1932 22 4 1 1929 597252993 597251073 0 3356
12 TraesCS6D01G375400 chr6A 94.920 1122 50 2 1072 2191 413577939 413576823 0 1749
13 TraesCS6D01G375400 chr4A 93.436 1691 94 5 1 1689 280911111 280909436 0 2492
14 TraesCS6D01G375400 chr4B 96.997 999 20 2 1195 2191 209107731 209108721 0 1670


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6D01G375400 chr6D 458939162 458941353 2191 True 4048 4048 100.000 1 2192 1 chr6D.!!$R1 2191
1 TraesCS6D01G375400 chr4D 123446795 123448986 2191 True 3847 3847 98.359 1 2191 1 chr4D.!!$R1 2190
2 TraesCS6D01G375400 chr3A 495102575 495104760 2185 True 3786 3786 97.903 1 2191 1 chr3A.!!$R1 2190
3 TraesCS6D01G375400 chr3B 92294548 92296732 2184 True 3781 3781 97.858 1 2191 1 chr3B.!!$R2 2190
4 TraesCS6D01G375400 chr3B 6008582 6010766 2184 True 3747 3747 97.584 1 2191 1 chr3B.!!$R1 2190
5 TraesCS6D01G375400 chr2B 234538975 234541160 2185 True 3775 3775 97.812 1 2191 1 chr2B.!!$R2 2190
6 TraesCS6D01G375400 chr2B 234500276 234502228 1952 True 3341 3341 97.501 233 2191 1 chr2B.!!$R1 1958
7 TraesCS6D01G375400 chr1A 278521194 278523378 2184 False 3764 3764 97.721 1 2191 1 chr1A.!!$F1 2190
8 TraesCS6D01G375400 chr1B 619193147 619195331 2184 True 3759 3759 97.675 1 2191 1 chr1B.!!$R1 2190
9 TraesCS6D01G375400 chr1B 348908985 348910375 1390 False 2163 2163 94.763 800 2189 1 chr1B.!!$F1 1389
10 TraesCS6D01G375400 chrUn 217907668 217909852 2184 False 3747 3747 97.584 1 2191 1 chrUn.!!$F1 2190
11 TraesCS6D01G375400 chr6A 597251073 597252993 1920 True 3356 3356 98.137 1 1929 1 chr6A.!!$R2 1928
12 TraesCS6D01G375400 chr6A 413576823 413577939 1116 True 1749 1749 94.920 1072 2191 1 chr6A.!!$R1 1119
13 TraesCS6D01G375400 chr4A 280909436 280911111 1675 True 2492 2492 93.436 1 1689 1 chr4A.!!$R1 1688
14 TraesCS6D01G375400 chr4B 209107731 209108721 990 False 1670 1670 96.997 1195 2191 1 chr4B.!!$F1 996

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
86 87 1.211457 GGATGTGGGAGCATCAACTCT 59.789 52.381 8.11 0.0 45.11 3.24 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1381 1395 0.846693 GAATCCCAGCATACCCCAGT 59.153 55.0 0.0 0.0 0.0 4.0 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
86 87 1.211457 GGATGTGGGAGCATCAACTCT 59.789 52.381 8.11 0.0 45.11 3.24
277 279 6.617879 TCGACGAATTAGAAGAGATGTCAAA 58.382 36.000 0.00 0.0 0.00 2.69
607 611 3.508840 CGGGCCATCAACCTTCGC 61.509 66.667 4.39 0.0 0.00 4.70
693 697 2.933287 TTCACCGGGGTGGAGCAT 60.933 61.111 17.31 0.0 45.43 3.79
1547 1561 6.389091 TCATTGTGCAATGTCCTAATCAAAC 58.611 36.000 20.21 0.0 46.15 2.93
1929 1946 1.956477 ACATCAAGGTTGTGGCTTGAC 59.044 47.619 0.00 0.0 39.49 3.18
2171 2188 1.787012 TTCGGGTCGAAGCACTAAAC 58.213 50.000 0.00 0.0 41.05 2.01
2191 2208 1.152922 AAAAGGACCGGGAAACGCA 60.153 52.632 6.32 0.0 42.52 5.24
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
86 87 2.038659 CCTCAAAAGCCCAAAGGAACA 58.961 47.619 0.0 0.0 33.47 3.18
333 335 4.264352 ACTGAATCCCCAATCCTTTGCTTA 60.264 41.667 0.0 0.0 0.00 3.09
1381 1395 0.846693 GAATCCCAGCATACCCCAGT 59.153 55.000 0.0 0.0 0.00 4.00
1695 1709 2.181975 CTTTACTCCTAACCCCACGGA 58.818 52.381 0.0 0.0 0.00 4.69
1929 1946 3.364062 CGTGTCAGCTTAGTTATCCTCG 58.636 50.000 0.0 0.0 0.00 4.63
2086 2103 2.567615 AGCTCACTAAAGAATGGGACGT 59.432 45.455 0.0 0.0 0.00 4.34
2171 2188 1.864176 CGTTTCCCGGTCCTTTTCG 59.136 57.895 0.0 0.0 0.00 3.46


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.