Multiple sequence alignment - TraesCS6D01G375300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6D01G375300 chr6D 100.000 2471 0 0 1 2471 458923537 458921067 0 4564
1 TraesCS6D01G375300 chr2B 98.584 2472 34 1 1 2471 449214509 449212038 0 4370
2 TraesCS6D01G375300 chr2B 97.898 2474 43 4 1 2471 234536333 234533866 0 4272
3 TraesCS6D01G375300 chr1A 98.503 2472 36 1 1 2471 278526017 278528488 0 4359
4 TraesCS6D01G375300 chr3A 98.301 2472 41 1 1 2471 495099935 495097464 0 4331
5 TraesCS6D01G375300 chr7A 97.939 2475 46 2 1 2471 563517273 563514800 0 4283
6 TraesCS6D01G375300 chr1B 97.937 2472 50 1 1 2471 619190507 619188036 0 4281
7 TraesCS6D01G375300 chr3D 97.857 2473 49 4 1 2471 501833556 501831086 0 4270
8 TraesCS6D01G375300 chr3B 97.694 2472 55 2 1 2471 6005942 6003472 0 4248


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6D01G375300 chr6D 458921067 458923537 2470 True 4564 4564 100.000 1 2471 1 chr6D.!!$R1 2470
1 TraesCS6D01G375300 chr2B 449212038 449214509 2471 True 4370 4370 98.584 1 2471 1 chr2B.!!$R2 2470
2 TraesCS6D01G375300 chr2B 234533866 234536333 2467 True 4272 4272 97.898 1 2471 1 chr2B.!!$R1 2470
3 TraesCS6D01G375300 chr1A 278526017 278528488 2471 False 4359 4359 98.503 1 2471 1 chr1A.!!$F1 2470
4 TraesCS6D01G375300 chr3A 495097464 495099935 2471 True 4331 4331 98.301 1 2471 1 chr3A.!!$R1 2470
5 TraesCS6D01G375300 chr7A 563514800 563517273 2473 True 4283 4283 97.939 1 2471 1 chr7A.!!$R1 2470
6 TraesCS6D01G375300 chr1B 619188036 619190507 2471 True 4281 4281 97.937 1 2471 1 chr1B.!!$R1 2470
7 TraesCS6D01G375300 chr3D 501831086 501833556 2470 True 4270 4270 97.857 1 2471 1 chr3D.!!$R1 2470
8 TraesCS6D01G375300 chr3B 6003472 6005942 2470 True 4248 4248 97.694 1 2471 1 chr3B.!!$R1 2470

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
384 385 1.09805 AGAATCATCAACAAGGGCGC 58.902 50.0 0.0 0.0 0.0 6.53 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1744 1748 5.692115 TTAGTAACTGCATCCAATCTCCA 57.308 39.13 0.0 0.0 0.0 3.86 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
277 278 5.221244 GGTATTGGGCATACAAGAACATTCC 60.221 44.000 0.00 0.00 39.86 3.01
278 279 3.448093 TGGGCATACAAGAACATTCCA 57.552 42.857 0.00 0.00 0.00 3.53
384 385 1.098050 AGAATCATCAACAAGGGCGC 58.902 50.000 0.00 0.00 0.00 6.53
688 689 3.602390 TTCGAAGCACTTCTTTTTCCG 57.398 42.857 8.65 0.00 37.44 4.30
1149 1152 4.112634 TCTATCGAGCCGTGAAAAAGATG 58.887 43.478 0.00 0.00 0.00 2.90
1913 1917 6.666678 TGGCCTAATTCTTCTTCTGATGATT 58.333 36.000 3.32 0.00 0.00 2.57
2178 2182 9.216117 AGTTTCTGTTATTCGTATTAACAGCTT 57.784 29.630 20.19 9.74 46.01 3.74
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
153 154 4.151867 GGTTGATAGTGGAAAAGTCGACAC 59.848 45.833 19.5 5.88 35.08 3.67
213 214 7.737972 TTTCAAATCCAGAAGTGAATCGTAA 57.262 32.000 0.0 0.00 30.51 3.18
277 278 7.951245 ACCCTTCCTCCTCTTACTAATACTATG 59.049 40.741 0.0 0.00 0.00 2.23
278 279 8.071235 ACCCTTCCTCCTCTTACTAATACTAT 57.929 38.462 0.0 0.00 0.00 2.12
384 385 6.858993 GGATAAGAATCTACAACGCACTAGAG 59.141 42.308 0.0 0.00 32.29 2.43
688 689 7.063898 GTCCTTAGGTTTCCGAAATAGTGTAAC 59.936 40.741 0.0 0.00 0.00 2.50
1107 1110 8.013947 CGATAGAGAATTTGATAAGCCAATGTG 58.986 37.037 0.0 0.00 39.76 3.21
1108 1111 7.933577 TCGATAGAGAATTTGATAAGCCAATGT 59.066 33.333 0.0 0.00 42.67 2.71
1149 1152 5.580297 TGGATTTGTTTCTGTCTTTTGTTGC 59.420 36.000 0.0 0.00 0.00 4.17
1186 1189 6.263516 AGTTACTCTACGTATTGCTTGACA 57.736 37.500 0.0 0.00 0.00 3.58
1744 1748 5.692115 TTAGTAACTGCATCCAATCTCCA 57.308 39.130 0.0 0.00 0.00 3.86
1913 1917 9.170734 CTATCTTTTTGATCAGAGGTTGAATCA 57.829 33.333 0.0 0.00 39.77 2.57
2178 2182 6.423182 CACATAAAAACATTCCCCCTAGAGA 58.577 40.000 0.0 0.00 0.00 3.10


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.