Multiple sequence alignment - TraesCS6D01G375100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6D01G375100 chr6D 100.000 2994 0 0 1 2994 458911249 458914242 0 5529
1 TraesCS6D01G375100 chr6D 98.654 2229 25 2 1 2229 124530593 124532816 0 3945
2 TraesCS6D01G375100 chr6D 98.429 764 10 2 2231 2994 108496072 108495311 0 1343
3 TraesCS6D01G375100 chrUn 98.655 2230 25 3 1 2229 189405554 189407779 0 3947
4 TraesCS6D01G375100 chrUn 98.822 764 9 0 2231 2994 182430463 182429700 0 1362
5 TraesCS6D01G375100 chrUn 98.562 765 10 1 2231 2994 231555325 231556089 0 1351
6 TraesCS6D01G375100 chr7B 98.655 2230 25 3 1 2229 644461914 644464139 0 3947
7 TraesCS6D01G375100 chr7D 98.654 2229 25 2 1 2229 381960690 381958467 0 3945
8 TraesCS6D01G375100 chr7D 98.609 2229 28 2 1 2229 626684765 626682540 0 3941
9 TraesCS6D01G375100 chr7D 98.609 2229 26 2 1 2229 382063149 382065372 0 3940
10 TraesCS6D01G375100 chr7D 98.562 765 10 1 2231 2994 6946941 6946177 0 1351
11 TraesCS6D01G375100 chr1D 98.520 2229 27 3 1 2229 141318663 141316441 0 3928
12 TraesCS6D01G375100 chr1B 98.431 2231 31 3 1 2229 668810692 668808464 0 3923
13 TraesCS6D01G375100 chr3A 98.340 2229 32 2 1 2229 633105727 633107950 0 3906
14 TraesCS6D01G375100 chr3A 98.560 764 11 0 2231 2994 593316093 593315330 0 1351
15 TraesCS6D01G375100 chr2B 98.953 764 8 0 2231 2994 449185346 449186109 0 1367
16 TraesCS6D01G375100 chr2B 98.560 764 10 1 2232 2994 234526292 234527055 0 1349
17 TraesCS6D01G375100 chr7A 98.691 764 10 0 2231 2994 60215937 60216700 0 1356
18 TraesCS6D01G375100 chr5A 98.560 764 11 0 2231 2994 420152948 420152185 0 1351


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6D01G375100 chr6D 458911249 458914242 2993 False 5529 5529 100.000 1 2994 1 chr6D.!!$F2 2993
1 TraesCS6D01G375100 chr6D 124530593 124532816 2223 False 3945 3945 98.654 1 2229 1 chr6D.!!$F1 2228
2 TraesCS6D01G375100 chr6D 108495311 108496072 761 True 1343 1343 98.429 2231 2994 1 chr6D.!!$R1 763
3 TraesCS6D01G375100 chrUn 189405554 189407779 2225 False 3947 3947 98.655 1 2229 1 chrUn.!!$F1 2228
4 TraesCS6D01G375100 chrUn 182429700 182430463 763 True 1362 1362 98.822 2231 2994 1 chrUn.!!$R1 763
5 TraesCS6D01G375100 chrUn 231555325 231556089 764 False 1351 1351 98.562 2231 2994 1 chrUn.!!$F2 763
6 TraesCS6D01G375100 chr7B 644461914 644464139 2225 False 3947 3947 98.655 1 2229 1 chr7B.!!$F1 2228
7 TraesCS6D01G375100 chr7D 381958467 381960690 2223 True 3945 3945 98.654 1 2229 1 chr7D.!!$R2 2228
8 TraesCS6D01G375100 chr7D 626682540 626684765 2225 True 3941 3941 98.609 1 2229 1 chr7D.!!$R3 2228
9 TraesCS6D01G375100 chr7D 382063149 382065372 2223 False 3940 3940 98.609 1 2229 1 chr7D.!!$F1 2228
10 TraesCS6D01G375100 chr7D 6946177 6946941 764 True 1351 1351 98.562 2231 2994 1 chr7D.!!$R1 763
11 TraesCS6D01G375100 chr1D 141316441 141318663 2222 True 3928 3928 98.520 1 2229 1 chr1D.!!$R1 2228
12 TraesCS6D01G375100 chr1B 668808464 668810692 2228 True 3923 3923 98.431 1 2229 1 chr1B.!!$R1 2228
13 TraesCS6D01G375100 chr3A 633105727 633107950 2223 False 3906 3906 98.340 1 2229 1 chr3A.!!$F1 2228
14 TraesCS6D01G375100 chr3A 593315330 593316093 763 True 1351 1351 98.560 2231 2994 1 chr3A.!!$R1 763
15 TraesCS6D01G375100 chr2B 449185346 449186109 763 False 1367 1367 98.953 2231 2994 1 chr2B.!!$F2 763
16 TraesCS6D01G375100 chr2B 234526292 234527055 763 False 1349 1349 98.560 2232 2994 1 chr2B.!!$F1 762
17 TraesCS6D01G375100 chr7A 60215937 60216700 763 False 1356 1356 98.691 2231 2994 1 chr7A.!!$F1 763
18 TraesCS6D01G375100 chr5A 420152185 420152948 763 True 1351 1351 98.560 2231 2994 1 chr5A.!!$R1 763

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
998 1004 2.573869 CGGAGATGTCGCCAGTGT 59.426 61.111 3.72 0.0 35.39 3.55 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2138 2146 0.179034 GGGCCTGCATCCACTAAGAG 60.179 60.0 0.84 0.0 0.0 2.85 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
240 241 3.161866 ACAACAAGAAACAACCACCAGT 58.838 40.909 0.00 0.00 0.00 4.00
321 322 9.878599 GTTCCGTCATATTCCAAATAACTTATG 57.121 33.333 0.00 0.00 0.00 1.90
483 488 3.764885 AGCCATAATGTCTCAAAACGC 57.235 42.857 0.00 0.00 0.00 4.84
506 511 6.287525 GCAGAGGCTATAGAGAAACTTTGAT 58.712 40.000 3.21 0.00 36.96 2.57
998 1004 2.573869 CGGAGATGTCGCCAGTGT 59.426 61.111 3.72 0.00 35.39 3.55
1023 1029 3.117663 TGGGCTTTGGGTTATGTAGATCC 60.118 47.826 0.00 0.00 0.00 3.36
1109 1115 2.024319 GAACGCTGCTTCGCTCTGT 61.024 57.895 0.00 0.00 0.00 3.41
1158 1164 2.797156 CTCGCTCTTTACCCGATCATTG 59.203 50.000 0.00 0.00 0.00 2.82
1533 1539 1.006832 CGTCTTTTATGCCTCGGGTG 58.993 55.000 0.00 0.00 0.00 4.61
1675 1681 1.867363 AGCTCCCGTTCATAGTTCCT 58.133 50.000 0.00 0.00 0.00 3.36
2011 2018 6.013812 ACTTCTGATCAATAGGAATAGGAGGC 60.014 42.308 0.00 0.00 0.00 4.70
2046 2054 5.820404 ATGATGAGCATCTATTGGAGTCA 57.180 39.130 11.37 0.00 38.60 3.41
2138 2146 4.730903 GCTTACGCTTAAGGGAAGAAATGC 60.731 45.833 24.81 13.93 37.33 3.56
2143 2151 4.876107 CGCTTAAGGGAAGAAATGCTCTTA 59.124 41.667 14.07 0.00 44.82 2.10
2229 2237 0.036010 CGAGCCACCAGGTTTGAGAT 60.036 55.000 0.00 0.00 37.19 2.75
2469 2478 2.037208 CGAAAAGGGTGGGGGCAT 59.963 61.111 0.00 0.00 0.00 4.40
2512 2521 4.404073 ACATCGAAACTTCCTATCTCAGCT 59.596 41.667 0.00 0.00 0.00 4.24
2682 2691 1.072173 GGGTGCCCAATTTGCTTTTCT 59.928 47.619 1.66 0.00 35.81 2.52
2787 2796 2.290367 CGTCTCAACTGCAATGGTGAAA 59.710 45.455 0.00 0.00 0.00 2.69
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
194 195 1.533731 GAATGCAACGAAAAGACCCGA 59.466 47.619 0.00 0.00 0.00 5.14
321 322 9.571804 CATTAGCGGTTAATACGTTGTAATTAC 57.428 33.333 8.75 8.75 30.75 1.89
483 488 8.729805 AAATCAAAGTTTCTCTATAGCCTCTG 57.270 34.615 0.00 0.00 0.00 3.35
998 1004 5.718801 TCTACATAACCCAAAGCCCATAA 57.281 39.130 0.00 0.00 0.00 1.90
1023 1029 4.573201 GCCACAATCCCATTCATCATTTTG 59.427 41.667 0.00 0.00 0.00 2.44
1109 1115 1.695114 ATGGGATCCGACGCATCCAA 61.695 55.000 19.26 8.88 41.68 3.53
1158 1164 1.281566 CGCCGCCCACAAAATGTTTC 61.282 55.000 0.00 0.00 0.00 2.78
1239 1245 0.900182 TCCAGAGCGAAGAGAAGGCA 60.900 55.000 0.00 0.00 0.00 4.75
1510 1516 2.479837 CCGAGGCATAAAAGACGCATA 58.520 47.619 0.00 0.00 0.00 3.14
1675 1681 3.531934 TCCTCGTGTATCGTCTGTAGA 57.468 47.619 0.00 0.00 40.80 2.59
2092 2100 4.213270 CGTAAAACTGAAGATTGTGAGGCA 59.787 41.667 0.00 0.00 0.00 4.75
2138 2146 0.179034 GGGCCTGCATCCACTAAGAG 60.179 60.000 0.84 0.00 0.00 2.85
2143 2151 3.736224 CCAGGGCCTGCATCCACT 61.736 66.667 28.51 0.00 0.00 4.00
2229 2237 4.126208 TCCAACGTTAATAGCATTCCGA 57.874 40.909 0.00 0.00 0.00 4.55
2406 2415 8.688151 AGATGTTCTGGTGTAAACTATAGAGAC 58.312 37.037 6.78 1.89 0.00 3.36
2469 2478 8.471609 TCGATGTGTATGTAGATTTGGTTCTAA 58.528 33.333 0.00 0.00 30.25 2.10
2512 2521 2.170607 GTGGGATGAAGGTGCTAGCTTA 59.829 50.000 17.23 0.00 35.86 3.09
2882 2891 0.459585 TATCCGGCACTTTCGTCTGC 60.460 55.000 0.00 0.00 0.00 4.26


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.