Multiple sequence alignment - TraesCS6D01G375000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6D01G375000 chr6D 100.000 2486 0 0 1 2486 458913223 458910738 0 4591
1 TraesCS6D01G375000 chr6D 98.793 2486 27 1 1 2486 124532564 124530082 0 4421
2 TraesCS6D01G375000 chr7D 98.793 2486 27 1 1 2486 381958719 381961201 0 4421
3 TraesCS6D01G375000 chr7D 98.713 2486 29 1 1 2486 382065120 382062638 0 4410
4 TraesCS6D01G375000 chr7D 98.673 2486 30 2 1 2486 626682793 626685275 0 4405
5 TraesCS6D01G375000 chr7D 98.351 2487 35 3 1 2486 203515035 203512554 0 4361
6 TraesCS6D01G375000 chr1D 98.713 2486 28 2 1 2486 141316693 141319174 0 4410
7 TraesCS6D01G375000 chr7B 98.673 2487 29 2 1 2486 644463886 644461403 0 4407
8 TraesCS6D01G375000 chr1B 98.513 2488 34 2 1 2486 668808717 668811203 0 4386


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6D01G375000 chr6D 458910738 458913223 2485 True 4591 4591 100.000 1 2486 1 chr6D.!!$R2 2485
1 TraesCS6D01G375000 chr6D 124530082 124532564 2482 True 4421 4421 98.793 1 2486 1 chr6D.!!$R1 2485
2 TraesCS6D01G375000 chr7D 381958719 381961201 2482 False 4421 4421 98.793 1 2486 1 chr7D.!!$F1 2485
3 TraesCS6D01G375000 chr7D 382062638 382065120 2482 True 4410 4410 98.713 1 2486 1 chr7D.!!$R2 2485
4 TraesCS6D01G375000 chr7D 626682793 626685275 2482 False 4405 4405 98.673 1 2486 1 chr7D.!!$F2 2485
5 TraesCS6D01G375000 chr7D 203512554 203515035 2481 True 4361 4361 98.351 1 2486 1 chr7D.!!$R1 2485
6 TraesCS6D01G375000 chr1D 141316693 141319174 2481 False 4410 4410 98.713 1 2486 1 chr1D.!!$F1 2485
7 TraesCS6D01G375000 chr7B 644461403 644463886 2483 True 4407 4407 98.673 1 2486 1 chr7B.!!$R1 2485
8 TraesCS6D01G375000 chr1B 668808717 668811203 2486 False 4386 4386 98.513 1 2486 1 chr1B.!!$F1 2485

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
735 736 0.900182 TCCAGAGCGAAGAGAAGGCA 60.9 55.0 0.0 0.0 0.0 4.75 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2280 2287 1.075601 ATCCTTTCAGGGCAAGGTCA 58.924 50.0 1.73 0.0 41.59 4.02 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
299 300 3.531934 TCCTCGTGTATCGTCTGTAGA 57.468 47.619 0.00 0.00 40.80 2.59
464 465 2.479837 CCGAGGCATAAAAGACGCATA 58.520 47.619 0.00 0.00 0.00 3.14
735 736 0.900182 TCCAGAGCGAAGAGAAGGCA 60.900 55.000 0.00 0.00 0.00 4.75
816 817 1.281566 CGCCGCCCACAAAATGTTTC 61.282 55.000 0.00 0.00 0.00 2.78
865 866 1.695114 ATGGGATCCGACGCATCCAA 61.695 55.000 19.26 8.88 41.68 3.53
951 952 4.573201 GCCACAATCCCATTCATCATTTTG 59.427 41.667 0.00 0.00 0.00 2.44
976 977 5.718801 TCTACATAACCCAAAGCCCATAA 57.281 39.130 0.00 0.00 0.00 1.90
1070 1071 1.666553 CTGCAAGCGGTTCGGTACA 60.667 57.895 0.00 0.00 36.27 2.90
1460 1461 2.359848 TCACGAAGTTCGAGACAAAGGA 59.640 45.455 30.77 11.55 43.74 3.36
1461 1462 3.120792 CACGAAGTTCGAGACAAAGGAA 58.879 45.455 30.77 0.00 43.74 3.36
1491 1494 8.729805 AAATCAAAGTTTCTCTATAGCCTCTG 57.270 34.615 0.00 0.00 0.00 3.35
1653 1659 9.571804 CATTAGCGGTTAATACGTTGTAATTAC 57.428 33.333 8.75 8.75 30.75 1.89
1780 1786 1.533731 GAATGCAACGAAAAGACCCGA 59.466 47.619 0.00 0.00 0.00 5.14
2010 2016 2.642171 ATCTCTGAGGGGTGTACCAA 57.358 50.000 4.59 0.00 42.91 3.67
2085 2092 3.181329 TCTTGGCTAGTGGAATGGAAGA 58.819 45.455 0.00 0.00 0.00 2.87
2237 2244 6.238593 GCTTCAATTTCTTCAGTCTCACAAGT 60.239 38.462 0.00 0.00 0.00 3.16
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
299 300 1.867363 AGCTCCCGTTCATAGTTCCT 58.133 50.000 0.00 0.00 0.00 3.36
441 442 1.006832 CGTCTTTTATGCCTCGGGTG 58.993 55.000 0.00 0.00 0.00 4.61
816 817 2.797156 CTCGCTCTTTACCCGATCATTG 59.203 50.000 0.00 0.00 0.00 2.82
865 866 2.024319 GAACGCTGCTTCGCTCTGT 61.024 57.895 0.00 0.00 0.00 3.41
951 952 3.117663 TGGGCTTTGGGTTATGTAGATCC 60.118 47.826 0.00 0.00 0.00 3.36
976 977 2.573869 CGGAGATGTCGCCAGTGT 59.426 61.111 3.72 0.00 35.39 3.55
1070 1071 8.541133 TCCTTTTGTTTGAAATTTCTTCGTTT 57.459 26.923 18.64 0.00 0.00 3.60
1491 1494 3.764885 AGCCATAATGTCTCAAAACGC 57.235 42.857 0.00 0.00 0.00 4.84
1653 1659 9.878599 GTTCCGTCATATTCCAAATAACTTATG 57.121 33.333 0.00 0.00 0.00 1.90
1734 1740 3.161866 ACAACAAGAAACAACCACCAGT 58.838 40.909 0.00 0.00 0.00 4.00
2034 2041 5.745227 AGAGTGACTTTCTCTTTTGAACCA 58.255 37.500 0.00 0.00 38.91 3.67
2085 2092 5.707764 GCAAAGTGGATAGGAAAGAGTCTTT 59.292 40.000 18.05 18.05 0.00 2.52
2237 2244 1.395045 TTTTGTTGCATGCGGACCCA 61.395 50.000 14.09 1.83 0.00 4.51
2280 2287 1.075601 ATCCTTTCAGGGCAAGGTCA 58.924 50.000 1.73 0.00 41.59 4.02


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.