Multiple sequence alignment - TraesCS6D01G374800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6D01G374800 chr6D 100.000 2718 0 0 1 2718 458901654 458898937 0 5020
1 TraesCS6D01G374800 chr6D 98.493 2720 36 3 1 2718 124520993 124518277 0 4791
2 TraesCS6D01G374800 chr5A 98.860 2720 26 2 1 2718 19245372 19248088 0 4846
3 TraesCS6D01G374800 chr7D 98.823 2718 29 1 1 2718 382053548 382050834 0 4839
4 TraesCS6D01G374800 chr7D 98.675 2718 33 1 1 2718 381927470 381924756 0 4817
5 TraesCS6D01G374800 chr7D 98.602 2718 35 1 1 2718 203503468 203500754 0 4806
6 TraesCS6D01G374800 chr7D 98.421 2724 31 4 1 2718 381970295 381973012 0 4782
7 TraesCS6D01G374800 chr7B 98.346 2720 35 3 1 2718 716875315 716878026 0 4765


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6D01G374800 chr6D 458898937 458901654 2717 True 5020 5020 100.000 1 2718 1 chr6D.!!$R2 2717
1 TraesCS6D01G374800 chr6D 124518277 124520993 2716 True 4791 4791 98.493 1 2718 1 chr6D.!!$R1 2717
2 TraesCS6D01G374800 chr5A 19245372 19248088 2716 False 4846 4846 98.860 1 2718 1 chr5A.!!$F1 2717
3 TraesCS6D01G374800 chr7D 382050834 382053548 2714 True 4839 4839 98.823 1 2718 1 chr7D.!!$R3 2717
4 TraesCS6D01G374800 chr7D 381924756 381927470 2714 True 4817 4817 98.675 1 2718 1 chr7D.!!$R2 2717
5 TraesCS6D01G374800 chr7D 203500754 203503468 2714 True 4806 4806 98.602 1 2718 1 chr7D.!!$R1 2717
6 TraesCS6D01G374800 chr7D 381970295 381973012 2717 False 4782 4782 98.421 1 2718 1 chr7D.!!$F1 2717
7 TraesCS6D01G374800 chr7B 716875315 716878026 2711 False 4765 4765 98.346 1 2718 1 chr7B.!!$F1 2717

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
708 714 0.036671 CGAAGGGGTTAGGAGCGTTT 60.037 55.0 0.0 0.0 0.0 3.6 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2681 2692 1.197721 GTGAACAGCCGTTTGATGGAG 59.802 52.381 0.0 0.0 34.75 3.86 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
119 120 4.333913 TCGGAGACTAGACTAGCGTTAT 57.666 45.455 9.52 0.00 0.00 1.89
153 154 6.402222 AGGAGACAGACAGAATTTACATCAC 58.598 40.000 0.00 0.00 0.00 3.06
262 267 6.128007 CCTTTGTAAGCGAAAATGTCCAGTAT 60.128 38.462 0.00 0.00 0.00 2.12
585 590 2.225142 ACTAACAGCTGAGTCCTCTCCA 60.225 50.000 23.35 0.00 39.75 3.86
706 712 0.323725 TACGAAGGGGTTAGGAGCGT 60.324 55.000 0.00 0.00 0.00 5.07
707 713 1.190178 ACGAAGGGGTTAGGAGCGTT 61.190 55.000 0.00 0.00 0.00 4.84
708 714 0.036671 CGAAGGGGTTAGGAGCGTTT 60.037 55.000 0.00 0.00 0.00 3.60
760 766 4.647399 ACGAAAAAGGAACCCATCTTTTCA 59.353 37.500 0.00 0.00 40.87 2.69
786 792 4.797868 TGAAAAATGTGAGTCTGTTTTGCG 59.202 37.500 0.00 0.00 0.00 4.85
871 877 6.239317 CCCGTGTTTGATCTTATCCATCTCTA 60.239 42.308 0.00 0.00 0.00 2.43
906 912 0.324830 GGCAGAGACCCCTGTAGAGT 60.325 60.000 0.00 0.00 36.57 3.24
910 916 3.226777 CAGAGACCCCTGTAGAGTATGG 58.773 54.545 0.00 0.00 0.00 2.74
1287 1298 8.774546 TTAGATATCTGGATAGATGGATGGAC 57.225 38.462 15.79 0.00 43.41 4.02
1445 1456 3.126879 CCTTCCGCATGCGCTTCA 61.127 61.111 34.00 14.42 38.24 3.02
1510 1521 2.552585 TTCGGATGGACTTCGCCGTC 62.553 60.000 0.00 0.00 43.92 4.79
1793 1804 3.314357 CGTACAAGGATATGGAGTCGACA 59.686 47.826 19.50 0.00 0.00 4.35
1810 1821 5.880887 AGTCGACAGTTGATGTATCAGACTA 59.119 40.000 19.50 0.00 44.17 2.59
2008 2019 1.104577 AACCCAAAGCGGCGAAGAAA 61.105 50.000 12.98 0.00 0.00 2.52
2068 2079 3.261580 TCCTGCGTATGAGAACATTGTG 58.738 45.455 0.00 0.00 37.87 3.33
2180 2191 4.541973 ACTATGGCGAATGCATCTATCA 57.458 40.909 0.00 0.00 45.35 2.15
2322 2333 0.178975 ACTTTCGTTTGGGCCATGGA 60.179 50.000 18.40 1.75 0.00 3.41
2333 2344 2.357836 CCATGGAGGCCAGTGCTT 59.642 61.111 5.56 0.00 36.75 3.91
2681 2692 3.181518 TGAACCGAACGTGAAAGTTGTTC 60.182 43.478 0.00 0.00 37.45 3.18
2689 2700 4.196193 ACGTGAAAGTTGTTCTCCATCAA 58.804 39.130 0.00 0.00 0.00 2.57
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
119 120 3.038280 TGTCTGTCTCCTTTGTCCTTCA 58.962 45.455 0.00 0.00 0.00 3.02
262 267 3.231818 AGGCTAAAAGCGAGATAGGCTA 58.768 45.455 13.45 0.00 46.81 3.93
585 590 1.679032 GGCAACTATCTCCTGCGGTTT 60.679 52.381 0.00 0.00 36.93 3.27
708 714 9.236691 CGACAAAGAAAGAATCATCTTGAAAAA 57.763 29.630 2.77 0.00 45.19 1.94
760 766 7.464444 CGCAAAACAGACTCACATTTTTCAATT 60.464 33.333 0.00 0.00 0.00 2.32
786 792 1.777272 AGAGGGGGATGGATAAAGTGC 59.223 52.381 0.00 0.00 0.00 4.40
871 877 4.047125 CCCACATGGAAGCGGGGT 62.047 66.667 0.00 0.00 37.39 4.95
906 912 2.180973 AGATCCTTGGCTCCTCTCCATA 59.819 50.000 0.00 0.00 32.92 2.74
910 916 3.304829 AGTAAGATCCTTGGCTCCTCTC 58.695 50.000 0.00 0.00 0.00 3.20
1133 1139 0.460987 CGAAGCACTGGAGTGATCCC 60.461 60.000 11.06 0.00 44.74 3.85
1510 1521 4.329462 TTTCCATTTTCGTTGGGAAAGG 57.671 40.909 0.00 0.00 44.95 3.11
1793 1804 5.596361 CAGGGTCTAGTCTGATACATCAACT 59.404 44.000 10.06 10.06 36.18 3.16
1810 1821 1.629043 TGCTACGAAAGACAGGGTCT 58.371 50.000 0.00 0.00 45.64 3.85
2068 2079 1.964223 TCGGCTATGACCTTCTCCATC 59.036 52.381 0.00 0.00 0.00 3.51
2322 2333 2.191400 TGATCTTAGAAGCACTGGCCT 58.809 47.619 3.32 0.00 42.56 5.19
2333 2344 5.699915 GCAGCATTGCTTCTATGATCTTAGA 59.300 40.000 8.83 12.98 46.95 2.10
2681 2692 1.197721 GTGAACAGCCGTTTGATGGAG 59.802 52.381 0.00 0.00 34.75 3.86
2689 2700 1.494824 GAGTTACGTGAACAGCCGTT 58.505 50.000 0.00 0.00 40.86 4.44


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.