Multiple sequence alignment - TraesCS6D01G374600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6D01G374600 chr6D 100.000 2439 0 0 1 2439 458899784 458897346 0 4505
1 TraesCS6D01G374600 chr6D 98.650 2444 28 2 1 2439 124519124 124516681 0 4325
2 TraesCS6D01G374600 chr7D 98.730 2440 27 2 1 2439 381972168 381974604 0 4331
3 TraesCS6D01G374600 chr1A 98.200 2445 36 6 1 2439 498689625 498692067 0 4265
4 TraesCS6D01G374600 chr1D 98.036 2444 41 4 1 2439 269408402 269405961 0 4241
5 TraesCS6D01G374600 chr1D 97.707 2442 52 3 1 2439 43235399 43237839 0 4196
6 TraesCS6D01G374600 chrUn 97.918 2449 41 4 1 2439 186206819 186209267 0 4231
7 TraesCS6D01G374600 chr4D 97.833 2446 45 3 1 2439 123337073 123334629 0 4217


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6D01G374600 chr6D 458897346 458899784 2438 True 4505 4505 100.000 1 2439 1 chr6D.!!$R2 2438
1 TraesCS6D01G374600 chr6D 124516681 124519124 2443 True 4325 4325 98.650 1 2439 1 chr6D.!!$R1 2438
2 TraesCS6D01G374600 chr7D 381972168 381974604 2436 False 4331 4331 98.730 1 2439 1 chr7D.!!$F1 2438
3 TraesCS6D01G374600 chr1A 498689625 498692067 2442 False 4265 4265 98.200 1 2439 1 chr1A.!!$F1 2438
4 TraesCS6D01G374600 chr1D 269405961 269408402 2441 True 4241 4241 98.036 1 2439 1 chr1D.!!$R1 2438
5 TraesCS6D01G374600 chr1D 43235399 43237839 2440 False 4196 4196 97.707 1 2439 1 chr1D.!!$F1 2438
6 TraesCS6D01G374600 chrUn 186206819 186209267 2448 False 4231 4231 97.918 1 2439 1 chrUn.!!$F1 2438
7 TraesCS6D01G374600 chr4D 123334629 123337073 2444 True 4217 4217 97.833 1 2439 1 chr4D.!!$R1 2438

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
452 453 0.178975 ACTTTCGTTTGGGCCATGGA 60.179 50.0 18.4 1.75 0.0 3.41 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1585 1590 0.178992 GCCCCGAATGGATTGGATCA 60.179 55.0 0.0 0.0 37.49 2.92 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
138 139 1.104577 AACCCAAAGCGGCGAAGAAA 61.105 50.000 12.98 0.00 0.00 2.52
198 199 3.261580 TCCTGCGTATGAGAACATTGTG 58.738 45.455 0.00 0.00 37.87 3.33
310 311 4.541973 ACTATGGCGAATGCATCTATCA 57.458 40.909 0.00 0.00 45.35 2.15
452 453 0.178975 ACTTTCGTTTGGGCCATGGA 60.179 50.000 18.40 1.75 0.00 3.41
463 464 2.357836 CCATGGAGGCCAGTGCTT 59.642 61.111 5.56 0.00 36.75 3.91
811 814 3.181518 TGAACCGAACGTGAAAGTTGTTC 60.182 43.478 0.00 0.00 37.45 3.18
819 822 4.196193 ACGTGAAAGTTGTTCTCCATCAA 58.804 39.130 0.00 0.00 0.00 2.57
1403 1408 1.048601 AGGACAAAGGAGAAGACGCA 58.951 50.000 0.00 0.00 0.00 5.24
1426 1431 4.345547 ACTTCGACTTTCTTTCTTCCTCCT 59.654 41.667 0.00 0.00 0.00 3.69
1481 1486 5.410924 GGAAGATTAGCAAAGCGGAAAAAT 58.589 37.500 0.00 0.00 0.00 1.82
1570 1575 0.383231 GGCGAGGCCTTCATTTCATG 59.617 55.000 6.77 0.00 46.69 3.07
1585 1590 2.519771 TCATGGGCAGAAGCAGAAAT 57.480 45.000 0.00 0.00 44.61 2.17
2186 2208 0.881118 CGCCTTTGGAAGCTAAAGCA 59.119 50.000 4.54 0.00 45.16 3.91
2202 2224 6.039829 AGCTAAAGCAAAAGTTGTAGAAAGCT 59.960 34.615 4.54 0.00 45.16 3.74
2380 2403 2.573009 GGGTAAGGTAGGCAAACCACTA 59.427 50.000 11.12 0.60 42.40 2.74
2429 2452 3.802866 AGCTAAGAAGTAGGCTGAATGC 58.197 45.455 0.00 0.00 41.94 3.56
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
198 199 1.964223 TCGGCTATGACCTTCTCCATC 59.036 52.381 0.00 0.00 0.00 3.51
452 453 2.191400 TGATCTTAGAAGCACTGGCCT 58.809 47.619 3.32 0.00 42.56 5.19
463 464 5.699915 GCAGCATTGCTTCTATGATCTTAGA 59.300 40.000 8.83 12.98 46.95 2.10
811 814 1.197721 GTGAACAGCCGTTTGATGGAG 59.802 52.381 0.00 0.00 34.75 3.86
819 822 1.494824 GAGTTACGTGAACAGCCGTT 58.505 50.000 0.00 0.00 40.86 4.44
1026 1030 6.592607 ACGTTCTAATAAAGAATTTCGGCTCA 59.407 34.615 0.00 0.00 45.84 4.26
1403 1408 4.345547 AGGAGGAAGAAAGAAAGTCGAAGT 59.654 41.667 0.00 0.00 0.00 3.01
1481 1486 1.941820 AGCTCCCCCTCCCTCTGTA 60.942 63.158 0.00 0.00 0.00 2.74
1570 1575 1.680207 GGATCATTTCTGCTTCTGCCC 59.320 52.381 0.00 0.00 38.71 5.36
1585 1590 0.178992 GCCCCGAATGGATTGGATCA 60.179 55.000 0.00 0.00 37.49 2.92
1918 1938 1.765074 GGGTGTTTGTGGGGAGCTA 59.235 57.895 0.00 0.00 0.00 3.32
2186 2208 5.048846 TCTCCCAGCTTTCTACAACTTTT 57.951 39.130 0.00 0.00 0.00 2.27
2202 2224 1.981256 AGCTTTCGCTTTTTCTCCCA 58.019 45.000 0.00 0.00 46.47 4.37
2380 2403 2.808543 CGTCAGTCTAAGGCAAAGCTTT 59.191 45.455 5.69 5.69 0.00 3.51


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.