Multiple sequence alignment - TraesCS6D01G365300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6D01G365300 chr6D 100.000 2618 0 0 1 2618 454644193 454641576 0.000000e+00 4835
1 TraesCS6D01G365300 chr1D 98.489 1986 27 3 1 1986 115569320 115567338 0.000000e+00 3498
2 TraesCS6D01G365300 chr1D 97.809 639 14 0 1980 2618 115567237 115566599 0.000000e+00 1103
3 TraesCS6D01G365300 chr1D 81.651 218 32 4 988 1204 468745819 468746029 9.630000e-40 174
4 TraesCS6D01G365300 chr7D 97.987 1987 29 5 1 1986 29884538 29882562 0.000000e+00 3437
5 TraesCS6D01G365300 chr7D 97.027 639 9 1 1980 2618 29882456 29881828 0.000000e+00 1066
6 TraesCS6D01G365300 chr7D 77.020 1027 177 25 921 1898 27485452 27486468 3.840000e-148 534
7 TraesCS6D01G365300 chr1A 89.610 385 33 4 826 1204 16477972 16477589 1.410000e-132 483
8 TraesCS6D01G365300 chr1A 82.110 218 31 4 988 1204 561587018 561587228 2.070000e-41 180
9 TraesCS6D01G365300 chr1A 87.500 136 12 5 1 135 6071800 6071669 4.510000e-33 152
10 TraesCS6D01G365300 chr1A 92.857 84 6 0 5 88 16478071 16477988 3.540000e-24 122
11 TraesCS6D01G365300 chr6B 86.982 169 17 5 1 166 712293847 712294013 4.450000e-43 185
12 TraesCS6D01G365300 chr7A 87.500 136 11 6 1 135 84693528 84693658 4.510000e-33 152
13 TraesCS6D01G365300 chr3A 87.500 136 11 6 1 135 93565953 93566083 4.510000e-33 152
14 TraesCS6D01G365300 chr5B 87.121 132 13 4 5 135 315244519 315244391 2.100000e-31 147
15 TraesCS6D01G365300 chr4A 86.232 138 13 5 1 135 636121796 636121662 7.550000e-31 145
16 TraesCS6D01G365300 chr4A 95.833 72 2 1 826 897 598522295 598522225 5.920000e-22 115
17 TraesCS6D01G365300 chr3D 81.935 155 13 5 159 299 528126667 528126514 1.650000e-22 117
18 TraesCS6D01G365300 chr3D 81.699 153 13 5 161 299 553219851 553219700 2.130000e-21 113


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6D01G365300 chr6D 454641576 454644193 2617 True 4835.0 4835 100.000 1 2618 1 chr6D.!!$R1 2617
1 TraesCS6D01G365300 chr1D 115566599 115569320 2721 True 2300.5 3498 98.149 1 2618 2 chr1D.!!$R1 2617
2 TraesCS6D01G365300 chr7D 29881828 29884538 2710 True 2251.5 3437 97.507 1 2618 2 chr7D.!!$R1 2617
3 TraesCS6D01G365300 chr7D 27485452 27486468 1016 False 534.0 534 77.020 921 1898 1 chr7D.!!$F1 977

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
208 211 3.255725 CCGCCTACGACAATTTTGACTA 58.744 45.455 0.0 0.0 43.93 2.59 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1690 1738 1.071128 GTGCTGCAAAATGCCCCAA 59.929 52.632 2.77 0.0 44.23 4.12 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
208 211 3.255725 CCGCCTACGACAATTTTGACTA 58.744 45.455 0.00 0.0 43.93 2.59
259 262 3.727387 TGGTAGCTCCCAGAAGCC 58.273 61.111 0.00 0.0 43.56 4.35
347 350 3.724374 TCAGCCGGATTTTTCGTATAGG 58.276 45.455 5.05 0.0 0.00 2.57
856 859 3.771479 ACTGCATATGAACCTGAGTCTGA 59.229 43.478 6.97 0.0 0.00 3.27
951 955 4.142838 TGAAGAAGTAATGAACTGCATGCG 60.143 41.667 14.09 10.5 38.88 4.73
980 984 7.730364 TCAGTCTGGTTTCTAACTGAATTTC 57.270 36.000 0.00 0.0 43.69 2.17
1361 1374 0.606604 AGACGGTGTGGTGTATGTCC 59.393 55.000 0.00 0.0 0.00 4.02
1551 1574 2.512885 CGCAAGAAGATTGCATGTGAC 58.487 47.619 12.55 0.0 45.14 3.67
1568 1591 3.761752 TGTGACATAGTGACGATGAAGGA 59.238 43.478 12.62 0.0 0.00 3.36
1690 1738 5.048294 GGTTGAATTGTCCCGATTTAGTTGT 60.048 40.000 0.00 0.0 0.00 3.32
1922 1970 4.343814 TGTCCGAAGCAGACATAATCCATA 59.656 41.667 0.00 0.0 0.00 2.74
2377 2537 0.108186 CAGCTAGAACGGACATGGCA 60.108 55.000 0.00 0.0 0.00 4.92
2570 2730 0.978146 ACTAGGCTGGTCCGCATCTT 60.978 55.000 0.00 0.0 40.77 2.40
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
86 89 2.606587 GCCTCAGGCTTTCCCAGGA 61.607 63.158 9.09 0.00 46.69 3.86
208 211 6.019748 AGTTCTATGCTAGCCCATACATACT 58.980 40.000 13.29 2.90 0.00 2.12
792 795 4.626042 AGGAATCATCAAGCGAGTCATAC 58.374 43.478 0.00 0.00 0.00 2.39
856 859 3.833650 TCCTGCATTCAATCCAAACACAT 59.166 39.130 0.00 0.00 0.00 3.21
951 955 4.444720 CAGTTAGAAACCAGACTGAACGAC 59.555 45.833 3.32 0.00 41.46 4.34
980 984 5.762045 ACATGAACTGAAAATCGGTTTGAG 58.238 37.500 0.00 0.00 45.29 3.02
1131 1143 1.349067 ACCTACGCTGGAACTTCCTT 58.651 50.000 9.31 0.00 37.46 3.36
1361 1374 4.081972 AGTGAACTCCAGTATGTAGTGCAG 60.082 45.833 0.00 0.00 29.29 4.41
1551 1574 6.865726 CCTTATTCTCCTTCATCGTCACTATG 59.134 42.308 0.00 0.00 0.00 2.23
1690 1738 1.071128 GTGCTGCAAAATGCCCCAA 59.929 52.632 2.77 0.00 44.23 4.12
1824 1872 5.009710 CCAATAGCATTGCACATTCTGAGAT 59.990 40.000 11.91 0.00 0.00 2.75
1922 1970 8.627208 ACAGATTTTCAGTGTCAAAGTCATAT 57.373 30.769 3.64 0.00 0.00 1.78
2290 2450 1.578117 CGAGCTCGAGACGAACGTC 60.578 63.158 32.06 17.79 44.86 4.34
2377 2537 2.507471 CCATTCCCTTTCTAGTCCTGCT 59.493 50.000 0.00 0.00 0.00 4.24
2503 2663 3.444805 GCGGGCTGAGTCGTCTCT 61.445 66.667 10.95 0.00 40.98 3.10
2570 2730 2.805546 GATGGCAGAGCGTACCGA 59.194 61.111 0.00 0.00 0.00 4.69


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.