Multiple sequence alignment - TraesCS6D01G357800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6D01G357800 chr6D 100.000 2513 0 0 1 2513 451143990 451146502 0 4641
1 TraesCS6D01G357800 chr6D 97.562 1682 35 5 1 1681 451600144 451598468 0 2874
2 TraesCS6D01G357800 chr6D 97.507 1685 34 6 1 1681 397854467 397852787 0 2872
3 TraesCS6D01G357800 chr6D 97.379 1679 36 7 1 1678 459129175 459130846 0 2850
4 TraesCS6D01G357800 chr6D 97.875 847 14 4 1668 2513 467236167 467237010 0 1461
5 TraesCS6D01G357800 chr2D 96.393 2523 51 16 1 2507 451670482 451667984 0 4119
6 TraesCS6D01G357800 chr2D 97.564 1683 37 3 1 1681 54047553 54045873 0 2878
7 TraesCS6D01G357800 chr2D 98.229 847 11 4 1668 2513 118668999 118668156 0 1478
8 TraesCS6D01G357800 chr3D 97.616 1678 31 6 4 1678 455925789 455927460 0 2868
9 TraesCS6D01G357800 chr3D 97.440 1680 33 7 1 1678 337615079 337616750 0 2856
10 TraesCS6D01G357800 chr3D 98.216 841 13 2 1668 2508 18705902 18705064 0 1469
11 TraesCS6D01G357800 chr1D 97.555 1677 32 6 4 1678 10688681 10690350 0 2861
12 TraesCS6D01G357800 chr5D 97.384 1682 37 5 1 1681 58009612 58007937 0 2856
13 TraesCS6D01G357800 chr5D 98.231 848 10 4 1668 2513 426132048 426132892 0 1478
14 TraesCS6D01G357800 chr5D 98.227 846 11 4 1668 2513 368657979 368658820 0 1476
15 TraesCS6D01G357800 chr5D 98.227 846 10 5 1668 2513 426356405 426355565 0 1474
16 TraesCS6D01G357800 chr7D 97.383 1681 36 7 1 1678 421675287 421676962 0 2854
17 TraesCS6D01G357800 chr7D 98.335 841 12 2 1668 2508 421676986 421677824 0 1474
18 TraesCS6D01G357800 chr4D 98.216 841 13 2 1668 2508 67958725 67957887 0 1469


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6D01G357800 chr6D 451143990 451146502 2512 False 4641 4641 100.000 1 2513 1 chr6D.!!$F1 2512
1 TraesCS6D01G357800 chr6D 451598468 451600144 1676 True 2874 2874 97.562 1 1681 1 chr6D.!!$R2 1680
2 TraesCS6D01G357800 chr6D 397852787 397854467 1680 True 2872 2872 97.507 1 1681 1 chr6D.!!$R1 1680
3 TraesCS6D01G357800 chr6D 459129175 459130846 1671 False 2850 2850 97.379 1 1678 1 chr6D.!!$F2 1677
4 TraesCS6D01G357800 chr6D 467236167 467237010 843 False 1461 1461 97.875 1668 2513 1 chr6D.!!$F3 845
5 TraesCS6D01G357800 chr2D 451667984 451670482 2498 True 4119 4119 96.393 1 2507 1 chr2D.!!$R3 2506
6 TraesCS6D01G357800 chr2D 54045873 54047553 1680 True 2878 2878 97.564 1 1681 1 chr2D.!!$R1 1680
7 TraesCS6D01G357800 chr2D 118668156 118668999 843 True 1478 1478 98.229 1668 2513 1 chr2D.!!$R2 845
8 TraesCS6D01G357800 chr3D 455925789 455927460 1671 False 2868 2868 97.616 4 1678 1 chr3D.!!$F2 1674
9 TraesCS6D01G357800 chr3D 337615079 337616750 1671 False 2856 2856 97.440 1 1678 1 chr3D.!!$F1 1677
10 TraesCS6D01G357800 chr3D 18705064 18705902 838 True 1469 1469 98.216 1668 2508 1 chr3D.!!$R1 840
11 TraesCS6D01G357800 chr1D 10688681 10690350 1669 False 2861 2861 97.555 4 1678 1 chr1D.!!$F1 1674
12 TraesCS6D01G357800 chr5D 58007937 58009612 1675 True 2856 2856 97.384 1 1681 1 chr5D.!!$R1 1680
13 TraesCS6D01G357800 chr5D 426132048 426132892 844 False 1478 1478 98.231 1668 2513 1 chr5D.!!$F2 845
14 TraesCS6D01G357800 chr5D 368657979 368658820 841 False 1476 1476 98.227 1668 2513 1 chr5D.!!$F1 845
15 TraesCS6D01G357800 chr5D 426355565 426356405 840 True 1474 1474 98.227 1668 2513 1 chr5D.!!$R2 845
16 TraesCS6D01G357800 chr7D 421675287 421677824 2537 False 2164 2854 97.859 1 2508 2 chr7D.!!$F1 2507
17 TraesCS6D01G357800 chr4D 67957887 67958725 838 True 1469 1469 98.216 1668 2508 1 chr4D.!!$R1 840

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
963 976 2.033602 TCGACCTCCTCGTCAGCA 59.966 61.111 0.0 0.0 43.45 4.41 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1862 1910 1.580845 CGCTTGTTTCTGGGCCTCAG 61.581 60.0 13.43 13.43 44.68 3.35 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
283 290 9.685276 TTTTCTCATAACCTTGTCACATATGAT 57.315 29.630 10.38 0.0 37.14 2.45
442 453 8.523915 TTATGGTAACTAGGTCTCATAAACGA 57.476 34.615 11.19 0.0 37.61 3.85
883 896 3.059325 CGAGCAGTTCCTCTGTTTCTTTG 60.059 47.826 0.00 0.0 45.23 2.77
963 976 2.033602 TCGACCTCCTCGTCAGCA 59.966 61.111 0.00 0.0 43.45 4.41
1042 1055 2.343758 GGACTGCGCCACTGAAGA 59.656 61.111 4.18 0.0 0.00 2.87
1317 1330 2.201732 GCAATCCGCGAGTTCAATCTA 58.798 47.619 8.23 0.0 0.00 1.98
1326 1339 3.495100 GCGAGTTCAATCTACCCCATGAT 60.495 47.826 0.00 0.0 0.00 2.45
1862 1910 3.068165 GCAATAGGCCCACAAAGGATAAC 59.932 47.826 0.00 0.0 41.22 1.89
2179 2231 6.619801 ACTACACTTTTGACTAAAGCCAAG 57.380 37.500 8.98 6.6 45.87 3.61
2488 2541 7.749808 ACATATAACACGACACCGATAGATAG 58.250 38.462 0.00 0.0 39.50 2.08
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
74 76 7.667219 AGCTTCATTTTGGAGTGAATAAGAAGA 59.333 33.333 0.00 0.00 34.18 2.87
283 290 1.462616 AATTCTTGCGCACATAGCCA 58.537 45.000 11.12 0.00 41.38 4.75
386 395 1.556451 ACTCGGTATAGGGGCGTTTTT 59.444 47.619 0.00 0.00 0.00 1.94
883 896 2.682155 AGAAGAACGAGAAGATGGGC 57.318 50.000 0.00 0.00 0.00 5.36
1042 1055 3.318313 TCTCCTCCTTTGAAGTCAACCT 58.682 45.455 0.00 0.00 35.28 3.50
1317 1330 2.044806 GAGCGGCACTATCATGGGGT 62.045 60.000 1.45 0.00 0.00 4.95
1813 1861 3.127533 CTCTTTGGGCCCGCGAAG 61.128 66.667 19.37 20.18 0.00 3.79
1862 1910 1.580845 CGCTTGTTTCTGGGCCTCAG 61.581 60.000 13.43 13.43 44.68 3.35


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.