Multiple sequence alignment - TraesCS6D01G343600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6D01G343600 chr6D 100.000 2969 0 0 1 2969 443448402 443451370 0.000000e+00 5483
1 TraesCS6D01G343600 chr6D 98.928 2986 12 1 1 2966 443344234 443347219 0.000000e+00 5319
2 TraesCS6D01G343600 chr6D 97.843 2967 55 4 2 2966 443550114 443553073 0.000000e+00 5116
3 TraesCS6D01G343600 chr6D 84.738 878 113 11 2108 2969 60314854 60313982 0.000000e+00 859
4 TraesCS6D01G343600 chr6D 84.642 879 116 10 2107 2969 132393274 132392399 0.000000e+00 857
5 TraesCS6D01G343600 chr6D 79.346 1254 219 27 866 2099 448507102 448508335 0.000000e+00 845
6 TraesCS6D01G343600 chr6D 95.745 517 21 1 1 517 433239361 433238846 0.000000e+00 832
7 TraesCS6D01G343600 chr6D 79.027 1254 217 35 866 2102 448050581 448049357 0.000000e+00 817
8 TraesCS6D01G343600 chr6D 80.729 384 72 2 1682 2063 448032554 448032171 6.220000e-77 298
9 TraesCS6D01G343600 chr2D 88.343 875 85 8 2109 2967 622368277 622369150 0.000000e+00 1035
10 TraesCS6D01G343600 chr7D 87.131 847 85 11 2140 2967 412871394 412870553 0.000000e+00 939
11 TraesCS6D01G343600 chr7D 95.906 513 21 0 1 513 596907841 596907329 0.000000e+00 832
12 TraesCS6D01G343600 chr7D 95.560 518 22 1 1 518 49812279 49811763 0.000000e+00 828
13 TraesCS6D01G343600 chr5B 84.695 869 117 9 2114 2967 521396356 521395489 0.000000e+00 854
14 TraesCS6D01G343600 chr5B 84.429 867 113 12 2113 2963 508066701 508067561 0.000000e+00 833
15 TraesCS6D01G343600 chr5B 82.569 327 41 9 2112 2423 701544531 701544206 1.050000e-69 274
16 TraesCS6D01G343600 chr5B 78.431 357 64 10 2114 2463 62952634 62952984 1.390000e-53 220
17 TraesCS6D01G343600 chr1D 96.680 512 17 0 1 512 467541381 467540870 0.000000e+00 852
18 TraesCS6D01G343600 chr1D 96.296 513 19 0 1 513 462313491 462312979 0.000000e+00 843
19 TraesCS6D01G343600 chr7A 84.800 875 102 21 2111 2967 474281196 474280335 0.000000e+00 850
20 TraesCS6D01G343600 chr3D 96.491 513 18 0 1 513 560042591 560043103 0.000000e+00 848
21 TraesCS6D01G343600 chr3D 96.101 513 20 0 1 513 4446614 4447126 0.000000e+00 837
22 TraesCS6D01G343600 chr3B 83.812 871 124 9 2107 2961 541061612 541062481 0.000000e+00 811
23 TraesCS6D01G343600 chr2B 87.561 611 72 4 2357 2967 656580463 656581069 0.000000e+00 704
24 TraesCS6D01G343600 chr6B 83.837 662 47 22 667 1323 42549873 42550479 2.570000e-160 575
25 TraesCS6D01G343600 chr6B 93.671 316 16 4 1673 1986 42550459 42550772 1.250000e-128 470
26 TraesCS6D01G343600 chr6A 91.162 396 34 1 1591 1986 24181281 24181675 1.210000e-148 536
27 TraesCS6D01G343600 chr6A 86.463 229 13 5 674 893 24181063 24181282 4.950000e-58 235
28 TraesCS6D01G343600 chr2A 84.356 505 63 6 2135 2624 83228681 83228178 5.760000e-132 481
29 TraesCS6D01G343600 chr3A 90.726 248 22 1 2110 2357 177112110 177112356 2.210000e-86 329


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6D01G343600 chr6D 443448402 443451370 2968 False 5483.0 5483 100.0000 1 2969 1 chr6D.!!$F2 2968
1 TraesCS6D01G343600 chr6D 443344234 443347219 2985 False 5319.0 5319 98.9280 1 2966 1 chr6D.!!$F1 2965
2 TraesCS6D01G343600 chr6D 443550114 443553073 2959 False 5116.0 5116 97.8430 2 2966 1 chr6D.!!$F3 2964
3 TraesCS6D01G343600 chr6D 60313982 60314854 872 True 859.0 859 84.7380 2108 2969 1 chr6D.!!$R1 861
4 TraesCS6D01G343600 chr6D 132392399 132393274 875 True 857.0 857 84.6420 2107 2969 1 chr6D.!!$R2 862
5 TraesCS6D01G343600 chr6D 448507102 448508335 1233 False 845.0 845 79.3460 866 2099 1 chr6D.!!$F4 1233
6 TraesCS6D01G343600 chr6D 433238846 433239361 515 True 832.0 832 95.7450 1 517 1 chr6D.!!$R3 516
7 TraesCS6D01G343600 chr6D 448049357 448050581 1224 True 817.0 817 79.0270 866 2102 1 chr6D.!!$R5 1236
8 TraesCS6D01G343600 chr2D 622368277 622369150 873 False 1035.0 1035 88.3430 2109 2967 1 chr2D.!!$F1 858
9 TraesCS6D01G343600 chr7D 412870553 412871394 841 True 939.0 939 87.1310 2140 2967 1 chr7D.!!$R2 827
10 TraesCS6D01G343600 chr7D 596907329 596907841 512 True 832.0 832 95.9060 1 513 1 chr7D.!!$R3 512
11 TraesCS6D01G343600 chr7D 49811763 49812279 516 True 828.0 828 95.5600 1 518 1 chr7D.!!$R1 517
12 TraesCS6D01G343600 chr5B 521395489 521396356 867 True 854.0 854 84.6950 2114 2967 1 chr5B.!!$R1 853
13 TraesCS6D01G343600 chr5B 508066701 508067561 860 False 833.0 833 84.4290 2113 2963 1 chr5B.!!$F2 850
14 TraesCS6D01G343600 chr1D 467540870 467541381 511 True 852.0 852 96.6800 1 512 1 chr1D.!!$R2 511
15 TraesCS6D01G343600 chr1D 462312979 462313491 512 True 843.0 843 96.2960 1 513 1 chr1D.!!$R1 512
16 TraesCS6D01G343600 chr7A 474280335 474281196 861 True 850.0 850 84.8000 2111 2967 1 chr7A.!!$R1 856
17 TraesCS6D01G343600 chr3D 560042591 560043103 512 False 848.0 848 96.4910 1 513 1 chr3D.!!$F2 512
18 TraesCS6D01G343600 chr3D 4446614 4447126 512 False 837.0 837 96.1010 1 513 1 chr3D.!!$F1 512
19 TraesCS6D01G343600 chr3B 541061612 541062481 869 False 811.0 811 83.8120 2107 2961 1 chr3B.!!$F1 854
20 TraesCS6D01G343600 chr2B 656580463 656581069 606 False 704.0 704 87.5610 2357 2967 1 chr2B.!!$F1 610
21 TraesCS6D01G343600 chr6B 42549873 42550772 899 False 522.5 575 88.7540 667 1986 2 chr6B.!!$F1 1319
22 TraesCS6D01G343600 chr6A 24181063 24181675 612 False 385.5 536 88.8125 674 1986 2 chr6A.!!$F1 1312
23 TraesCS6D01G343600 chr2A 83228178 83228681 503 True 481.0 481 84.3560 2135 2624 1 chr2A.!!$R1 489

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
161 162 0.530744 GCACTGGTCCATACTGTCGA 59.469 55.0 0.0 0.0 0.0 4.2 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2737 3169 4.718961 CTTGGTATCTATGGTGGGAAAGG 58.281 47.826 0.0 0.0 0.0 3.11 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
161 162 0.530744 GCACTGGTCCATACTGTCGA 59.469 55.000 0.00 0.0 0.00 4.20
798 808 0.745468 GGTACTACCTCCAGCCGAAG 59.255 60.000 0.00 0.0 34.73 3.79
1070 1092 2.496470 GGTACCACTTTCTCACGATCCT 59.504 50.000 7.15 0.0 0.00 3.24
2737 3169 3.552604 TTCTTGTGCACTAATTTCCGC 57.447 42.857 19.41 0.0 0.00 5.54
2909 3344 2.630098 TCATCCATTCCTAGCCTCTTCG 59.370 50.000 0.00 0.0 0.00 3.79
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
161 162 1.282570 CGCCACGCACTCAAAATGT 59.717 52.632 0.0 0.0 0.00 2.71
336 337 2.107204 GCTGGACCCATCACTTATCCAT 59.893 50.000 0.0 0.0 38.74 3.41
2737 3169 4.718961 CTTGGTATCTATGGTGGGAAAGG 58.281 47.826 0.0 0.0 0.00 3.11
2909 3344 3.190535 TGCAATAAAGCGAAGGAGGTTTC 59.809 43.478 0.0 0.0 41.37 2.78


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.