Multiple sequence alignment - TraesCS6D01G325800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6D01G325800 chr6D 100.000 2252 0 0 1 2252 431400307 431398056 0.000000e+00 4159
1 TraesCS6D01G325800 chr2D 99.024 2255 11 4 1 2252 628285949 628283703 0.000000e+00 4032
2 TraesCS6D01G325800 chr2D 97.499 2239 39 9 1 2230 334226202 334223972 0.000000e+00 3808
3 TraesCS6D01G325800 chr1D 98.715 2256 23 4 1 2252 254489982 254487729 0.000000e+00 4000
4 TraesCS6D01G325800 chr1D 98.890 1621 11 3 1 1614 394179193 394177573 0.000000e+00 2887
5 TraesCS6D01G325800 chr1D 95.952 1754 56 8 500 2252 244408395 244406656 0.000000e+00 2832
6 TraesCS6D01G325800 chr1D 95.893 1753 58 7 500 2252 244401944 244400206 0.000000e+00 2826
7 TraesCS6D01G325800 chr1D 94.983 1754 74 6 500 2252 244423932 244422192 0.000000e+00 2739
8 TraesCS6D01G325800 chr3D 98.314 2254 29 7 1 2252 21897836 21895590 0.000000e+00 3943
9 TraesCS6D01G325800 chr5D 97.357 2270 34 9 1 2251 329131425 329133687 0.000000e+00 3836
10 TraesCS6D01G325800 chr2A 97.126 2262 53 7 1 2252 276440794 276443053 0.000000e+00 3807
11 TraesCS6D01G325800 chr2A 97.030 2256 52 7 1 2252 335826560 335824316 0.000000e+00 3781
12 TraesCS6D01G325800 chrUn 98.990 990 4 3 1 984 317472907 317473896 0.000000e+00 1768
13 TraesCS6D01G325800 chr7B 98.413 189 2 1 19 207 8175322 8175135 4.640000e-87 331
14 TraesCS6D01G325800 chr7B 97.884 189 2 2 19 207 8018422 8018236 2.160000e-85 326


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6D01G325800 chr6D 431398056 431400307 2251 True 4159 4159 100.000 1 2252 1 chr6D.!!$R1 2251
1 TraesCS6D01G325800 chr2D 628283703 628285949 2246 True 4032 4032 99.024 1 2252 1 chr2D.!!$R2 2251
2 TraesCS6D01G325800 chr2D 334223972 334226202 2230 True 3808 3808 97.499 1 2230 1 chr2D.!!$R1 2229
3 TraesCS6D01G325800 chr1D 254487729 254489982 2253 True 4000 4000 98.715 1 2252 1 chr1D.!!$R4 2251
4 TraesCS6D01G325800 chr1D 394177573 394179193 1620 True 2887 2887 98.890 1 1614 1 chr1D.!!$R5 1613
5 TraesCS6D01G325800 chr1D 244406656 244408395 1739 True 2832 2832 95.952 500 2252 1 chr1D.!!$R2 1752
6 TraesCS6D01G325800 chr1D 244400206 244401944 1738 True 2826 2826 95.893 500 2252 1 chr1D.!!$R1 1752
7 TraesCS6D01G325800 chr1D 244422192 244423932 1740 True 2739 2739 94.983 500 2252 1 chr1D.!!$R3 1752
8 TraesCS6D01G325800 chr3D 21895590 21897836 2246 True 3943 3943 98.314 1 2252 1 chr3D.!!$R1 2251
9 TraesCS6D01G325800 chr5D 329131425 329133687 2262 False 3836 3836 97.357 1 2251 1 chr5D.!!$F1 2250
10 TraesCS6D01G325800 chr2A 276440794 276443053 2259 False 3807 3807 97.126 1 2252 1 chr2A.!!$F1 2251
11 TraesCS6D01G325800 chr2A 335824316 335826560 2244 True 3781 3781 97.030 1 2252 1 chr2A.!!$R1 2251
12 TraesCS6D01G325800 chrUn 317472907 317473896 989 False 1768 1768 98.990 1 984 1 chrUn.!!$F1 983

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
406 426 5.935945 TGAACTCCAACCAAAGTAGATTCA 58.064 37.5 0.0 0.0 0.0 2.57 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1805 1849 1.11295 GTAAGGACCCGCTAAGCTCT 58.887 55.0 0.0 0.0 0.0 4.09 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
406 426 5.935945 TGAACTCCAACCAAAGTAGATTCA 58.064 37.500 0.0 0.0 0.00 2.57
1174 1210 3.424433 GCCAAACGAGTATTTCACGGAAG 60.424 47.826 0.0 0.0 34.65 3.46
1208 1244 2.874849 TCCGTTAATAACCGACCGTTC 58.125 47.619 0.0 0.0 35.79 3.95
1805 1849 9.959749 GACCAGATTGTAAACATGAAAAAGTAA 57.040 29.630 0.0 0.0 0.00 2.24
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
212 220 4.354087 ACTCCAAAAAGAGGGTCCTATTGT 59.646 41.667 0.00 0.0 38.26 2.71
406 426 6.702329 AGGATAATTGAAGTGACTCGTCTTT 58.298 36.000 0.00 0.0 0.00 2.52
1174 1210 0.958876 AACGGAATTCCTTGTCGGCC 60.959 55.000 22.05 0.0 0.00 6.13
1208 1244 7.818493 TCATCGAGTTGTTCTAAAGAATCAG 57.182 36.000 0.00 0.0 36.33 2.90
1805 1849 1.112950 GTAAGGACCCGCTAAGCTCT 58.887 55.000 0.00 0.0 0.00 4.09


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.