Multiple sequence alignment - TraesCS6D01G316700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6D01G316700 chr6D 100.000 2414 0 0 1 2414 425979105 425976692 0 4458
1 TraesCS6D01G316700 chr6D 98.306 1594 22 5 1 1592 458963782 458965372 0 2789
2 TraesCS6D01G316700 chrUn 98.493 1593 21 3 1 1592 221549585 221547995 0 2806
3 TraesCS6D01G316700 chrUn 98.180 1593 26 3 1 1592 186192583 186190993 0 2778
4 TraesCS6D01G316700 chrUn 98.663 823 11 0 1592 2414 381707988 381708810 0 1459
5 TraesCS6D01G316700 chr7B 97.803 1593 33 2 1 1592 743004895 743006486 0 2747
6 TraesCS6D01G316700 chr7B 95.731 1593 61 4 1 1592 247459881 247461467 0 2558
7 TraesCS6D01G316700 chr3A 97.431 1596 33 6 1 1592 51914991 51916582 0 2713
8 TraesCS6D01G316700 chr6A 96.487 1594 50 5 1 1592 79142510 79144099 0 2628
9 TraesCS6D01G316700 chr6A 96.400 750 26 1 1592 2341 298330219 298330967 0 1234
10 TraesCS6D01G316700 chr3D 95.922 1594 53 5 1 1592 308579294 308577711 0 2573
11 TraesCS6D01G316700 chr1B 95.417 1593 64 6 1 1592 499826022 499827606 0 2529
12 TraesCS6D01G316700 chr7D 98.906 823 9 0 1592 2414 381878223 381879045 0 1471
13 TraesCS6D01G316700 chr7D 98.177 823 15 0 1592 2414 203526391 203527213 0 1437
14 TraesCS6D01G316700 chr7D 95.504 823 37 0 1592 2414 307178258 307179080 0 1315
15 TraesCS6D01G316700 chr4D 98.177 823 15 0 1592 2414 134972859 134972037 0 1437
16 TraesCS6D01G316700 chr4D 98.177 823 14 1 1592 2414 123727413 123728234 0 1435
17 TraesCS6D01G316700 chr2D 98.177 823 15 0 1592 2414 635022892 635022070 0 1437
18 TraesCS6D01G316700 chr4A 95.261 823 38 1 1592 2414 295161452 295162273 0 1303


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6D01G316700 chr6D 425976692 425979105 2413 True 4458 4458 100.000 1 2414 1 chr6D.!!$R1 2413
1 TraesCS6D01G316700 chr6D 458963782 458965372 1590 False 2789 2789 98.306 1 1592 1 chr6D.!!$F1 1591
2 TraesCS6D01G316700 chrUn 221547995 221549585 1590 True 2806 2806 98.493 1 1592 1 chrUn.!!$R2 1591
3 TraesCS6D01G316700 chrUn 186190993 186192583 1590 True 2778 2778 98.180 1 1592 1 chrUn.!!$R1 1591
4 TraesCS6D01G316700 chrUn 381707988 381708810 822 False 1459 1459 98.663 1592 2414 1 chrUn.!!$F1 822
5 TraesCS6D01G316700 chr7B 743004895 743006486 1591 False 2747 2747 97.803 1 1592 1 chr7B.!!$F2 1591
6 TraesCS6D01G316700 chr7B 247459881 247461467 1586 False 2558 2558 95.731 1 1592 1 chr7B.!!$F1 1591
7 TraesCS6D01G316700 chr3A 51914991 51916582 1591 False 2713 2713 97.431 1 1592 1 chr3A.!!$F1 1591
8 TraesCS6D01G316700 chr6A 79142510 79144099 1589 False 2628 2628 96.487 1 1592 1 chr6A.!!$F1 1591
9 TraesCS6D01G316700 chr6A 298330219 298330967 748 False 1234 1234 96.400 1592 2341 1 chr6A.!!$F2 749
10 TraesCS6D01G316700 chr3D 308577711 308579294 1583 True 2573 2573 95.922 1 1592 1 chr3D.!!$R1 1591
11 TraesCS6D01G316700 chr1B 499826022 499827606 1584 False 2529 2529 95.417 1 1592 1 chr1B.!!$F1 1591
12 TraesCS6D01G316700 chr7D 381878223 381879045 822 False 1471 1471 98.906 1592 2414 1 chr7D.!!$F3 822
13 TraesCS6D01G316700 chr7D 203526391 203527213 822 False 1437 1437 98.177 1592 2414 1 chr7D.!!$F1 822
14 TraesCS6D01G316700 chr7D 307178258 307179080 822 False 1315 1315 95.504 1592 2414 1 chr7D.!!$F2 822
15 TraesCS6D01G316700 chr4D 134972037 134972859 822 True 1437 1437 98.177 1592 2414 1 chr4D.!!$R1 822
16 TraesCS6D01G316700 chr4D 123727413 123728234 821 False 1435 1435 98.177 1592 2414 1 chr4D.!!$F1 822
17 TraesCS6D01G316700 chr2D 635022070 635022892 822 True 1437 1437 98.177 1592 2414 1 chr2D.!!$R1 822
18 TraesCS6D01G316700 chr4A 295161452 295162273 821 False 1303 1303 95.261 1592 2414 1 chr4A.!!$F1 822

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
998 1004 0.462225 GGACGGCTTAAGCTCTTCCC 60.462 60.0 25.88 15.79 41.7 3.97 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1831 1842 0.037697 CGGTGTGGTCCTCGATTTCA 60.038 55.0 0.0 0.0 0.0 2.69 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
120 122 4.043310 TCCTTCCAGAACCTCACAATCATT 59.957 41.667 0.00 0.00 0.00 2.57
240 242 4.215908 AGGAGTGAGGTAGATTCGCATTA 58.784 43.478 0.00 0.00 0.00 1.90
309 311 6.345298 GCTCTTTCTTCTATTGGCTAGTCTT 58.655 40.000 0.00 0.00 0.00 3.01
418 420 4.461431 CCGGCATTAGGTAAAAGGAAAAGT 59.539 41.667 0.00 0.00 0.00 2.66
626 628 6.436218 GCCCCTCTTTGATAAGGAAAGTTTTA 59.564 38.462 0.00 0.00 34.35 1.52
998 1004 0.462225 GGACGGCTTAAGCTCTTCCC 60.462 60.000 25.88 15.79 41.70 3.97
1082 1088 7.880265 ATCAAAGAATAGGGCCTTATCTACT 57.120 36.000 13.45 5.73 0.00 2.57
1156 1162 4.627058 TCACGCAACTGATTCTTTCACTA 58.373 39.130 0.00 0.00 0.00 2.74
1398 1406 9.554395 GAGGATCTTAGAAGGGAATTAGAAAAG 57.446 37.037 0.00 0.00 0.00 2.27
1551 1562 3.627123 TGACAAATATGGTTCGATGGCTG 59.373 43.478 0.00 0.00 0.00 4.85
1665 1676 6.418057 AGAAGGCAACAACCATTTCATTTA 57.582 33.333 0.00 0.00 41.41 1.40
1831 1842 7.509546 AGATACCGGTTCAATATGTCATTTCT 58.490 34.615 15.04 0.00 0.00 2.52
1960 1971 1.068472 CAGCGTTAGGTAGGATAGGCG 60.068 57.143 0.00 0.00 0.00 5.52
1991 2002 0.036577 GATATGCTCATCCGCTGCCT 60.037 55.000 0.00 0.00 0.00 4.75
2224 2236 4.333649 TCTGCTAAAGATTTTGATGCCTCG 59.666 41.667 0.00 0.00 0.00 4.63
2358 2370 3.284617 AGTGCCTTTTACTTTGGTTCGT 58.715 40.909 0.00 0.00 0.00 3.85
2359 2371 3.066203 AGTGCCTTTTACTTTGGTTCGTG 59.934 43.478 0.00 0.00 0.00 4.35
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
80 81 0.524862 GGAGACGACGTAGGCTGAAA 59.475 55.000 9.45 0.00 0.00 2.69
240 242 6.391227 TCCTTTTTCTTCGCTTTCTTCAAT 57.609 33.333 0.00 0.00 0.00 2.57
309 311 9.859427 CAAAAGAAATTGAAACTATCATGCCTA 57.141 29.630 0.00 0.00 38.03 3.93
418 420 8.352137 TGATATTTCTGGATGCTTTTGAGAAA 57.648 30.769 0.00 0.00 37.14 2.52
771 777 8.610035 GGGAGAAGAATAATCGAAATAAAACGT 58.390 33.333 0.00 0.00 0.00 3.99
801 807 1.399791 GAGGCTCCGAAAAGATTGCAG 59.600 52.381 2.15 0.00 0.00 4.41
998 1004 7.965107 GCATACTAGACAACTTTTCTTCCATTG 59.035 37.037 0.00 0.00 0.00 2.82
1082 1088 1.112113 GACCAAGTAGGGCTCGATCA 58.888 55.000 0.00 0.00 44.70 2.92
1156 1162 5.344743 TCTTGATAAGACGCTTGGAGAAT 57.655 39.130 2.86 0.00 31.20 2.40
1344 1350 0.605083 ACAAGTCGAGAGCATGCTCA 59.395 50.000 40.91 23.68 44.99 4.26
1551 1562 7.711339 CCAATATCCTTGTGGTTAGTAGAGAAC 59.289 40.741 0.00 0.00 34.23 3.01
1831 1842 0.037697 CGGTGTGGTCCTCGATTTCA 60.038 55.000 0.00 0.00 0.00 2.69
1934 1945 4.772886 ATCCTACCTAACGCTGGATTTT 57.227 40.909 0.00 0.00 34.21 1.82
1960 1971 5.071115 GGATGAGCATATCCCTAGAATACCC 59.929 48.000 7.78 0.00 40.64 3.69
1991 2002 3.449377 TGGACAGATATGAACCTTACGCA 59.551 43.478 0.00 0.00 0.00 5.24
2224 2236 1.609072 GGACTCTGTTTTGCAAGGACC 59.391 52.381 0.00 0.00 0.00 4.46
2358 2370 1.412710 GCTAATGGGACGGTCATCTCA 59.587 52.381 10.76 3.15 32.30 3.27
2359 2371 1.270358 GGCTAATGGGACGGTCATCTC 60.270 57.143 10.76 0.00 0.00 2.75


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.