Multiple sequence alignment - TraesCS6D01G310000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6D01G310000 chr6D 100.000 2303 0 0 1 2303 420171510 420173812 0 4253
1 TraesCS6D01G310000 chr3D 98.179 2307 38 1 1 2303 334427 336733 0 4024
2 TraesCS6D01G310000 chr3D 97.746 2307 43 2 1 2303 468955311 468957612 0 3964
3 TraesCS6D01G310000 chr2D 98.179 2307 38 1 1 2303 617341038 617343344 0 4024
4 TraesCS6D01G310000 chr2D 97.751 2312 43 3 1 2303 130078841 130076530 0 3973
5 TraesCS6D01G310000 chr1D 98.137 2308 38 2 1 2303 316243676 316241369 0 4019
6 TraesCS6D01G310000 chr4D 97.964 2308 42 2 1 2303 491381783 491384090 0 3997
7 TraesCS6D01G310000 chr5D 97.140 2308 55 4 1 2303 78602640 78600339 0 3886
8 TraesCS6D01G310000 chr5D 98.631 1753 24 0 1 1753 555413829 555415581 0 3105
9 TraesCS6D01G310000 chr4A 96.365 2311 66 4 1 2303 731637056 731634756 0 3786
10 TraesCS6D01G310000 chr2B 93.584 904 47 2 1401 2303 191887813 191886920 0 1338
11 TraesCS6D01G310000 chr2A 94.524 767 30 5 1537 2303 695189713 695190467 0 1173


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6D01G310000 chr6D 420171510 420173812 2302 False 4253 4253 100.000 1 2303 1 chr6D.!!$F1 2302
1 TraesCS6D01G310000 chr3D 334427 336733 2306 False 4024 4024 98.179 1 2303 1 chr3D.!!$F1 2302
2 TraesCS6D01G310000 chr3D 468955311 468957612 2301 False 3964 3964 97.746 1 2303 1 chr3D.!!$F2 2302
3 TraesCS6D01G310000 chr2D 617341038 617343344 2306 False 4024 4024 98.179 1 2303 1 chr2D.!!$F1 2302
4 TraesCS6D01G310000 chr2D 130076530 130078841 2311 True 3973 3973 97.751 1 2303 1 chr2D.!!$R1 2302
5 TraesCS6D01G310000 chr1D 316241369 316243676 2307 True 4019 4019 98.137 1 2303 1 chr1D.!!$R1 2302
6 TraesCS6D01G310000 chr4D 491381783 491384090 2307 False 3997 3997 97.964 1 2303 1 chr4D.!!$F1 2302
7 TraesCS6D01G310000 chr5D 78600339 78602640 2301 True 3886 3886 97.140 1 2303 1 chr5D.!!$R1 2302
8 TraesCS6D01G310000 chr5D 555413829 555415581 1752 False 3105 3105 98.631 1 1753 1 chr5D.!!$F1 1752
9 TraesCS6D01G310000 chr4A 731634756 731637056 2300 True 3786 3786 96.365 1 2303 1 chr4A.!!$R1 2302
10 TraesCS6D01G310000 chr2B 191886920 191887813 893 True 1338 1338 93.584 1401 2303 1 chr2B.!!$R1 902
11 TraesCS6D01G310000 chr2A 695189713 695190467 754 False 1173 1173 94.524 1537 2303 1 chr2A.!!$F1 766

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
452 465 1.701847 ACTGACACTGGCAGGAGATTT 59.298 47.619 20.34 0.0 37.69 2.17 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1983 2007 0.033504 CACCAACACTACTGGCTCGT 59.966 55.0 0.0 0.0 37.48 4.18 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
187 194 6.102663 CAGATGGAGTACTTTGTAAGTCAGG 58.897 44.000 0.00 0.00 41.77 3.86
256 269 7.652554 AGGGTTAGGGTTTGAAGATATTTGAT 58.347 34.615 0.00 0.00 0.00 2.57
345 358 4.040936 ACTCCTGACACTGTGATAGACT 57.959 45.455 15.86 0.00 0.00 3.24
379 392 3.141398 GGCTTGTGACTGAATCTGACAA 58.859 45.455 0.00 0.00 0.00 3.18
452 465 1.701847 ACTGACACTGGCAGGAGATTT 59.298 47.619 20.34 0.00 37.69 2.17
764 777 5.139727 TGATTTTCAGGATGGTGTGAACTT 58.860 37.500 0.00 0.00 36.16 2.66
931 944 3.022406 GAGCTTGATTCTCTGGCCAATT 58.978 45.455 7.01 0.00 0.00 2.32
1148 1161 7.930325 TCAGAGTCAAGCTGATATAATCCAAAG 59.070 37.037 0.00 0.00 37.46 2.77
1266 1279 1.901833 GGTCATGGGTGCAAGGAAAAT 59.098 47.619 0.00 0.00 0.00 1.82
1409 1422 7.728981 CCCTGATCTACCTATGAACTACCTTTA 59.271 40.741 0.00 0.00 0.00 1.85
1478 1492 1.004277 GGTGGTGTTTGCCCTGATCTA 59.996 52.381 0.00 0.00 0.00 1.98
1572 1586 7.798516 GTCTGATGTAGTTTATTTGTGTGTGTG 59.201 37.037 0.00 0.00 0.00 3.82
1622 1636 8.894409 TGTTTACTTCATAAATTGCTTCATCG 57.106 30.769 0.00 0.00 35.23 3.84
1947 1971 1.548357 GCTCTGGCACCTCCTCTTCA 61.548 60.000 0.00 0.00 38.54 3.02
1983 2007 1.453379 GATGGGAGGAGGACGTCGA 60.453 63.158 9.92 0.00 0.00 4.20
1992 2016 3.735029 GGACGTCGACGAGCCAGT 61.735 66.667 41.52 20.46 43.02 4.00
1997 2021 1.874562 GTCGACGAGCCAGTAGTGT 59.125 57.895 0.00 0.00 0.00 3.55
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
187 194 3.497942 GGAGAGGGAGAGGATAGACTGAC 60.498 56.522 0.00 0.0 0.00 3.51
345 358 2.703536 TCACAAGCCCACAGAAACTAGA 59.296 45.455 0.00 0.0 0.00 2.43
452 465 6.437477 CCATTACCTCAGTAGCACATCCTATA 59.563 42.308 0.00 0.0 0.00 1.31
541 554 6.908870 AAGGAAAATTCAGAAAAACAGCAC 57.091 33.333 0.00 0.0 0.00 4.40
764 777 1.697432 CTACCCACTCCAGAACACCAA 59.303 52.381 0.00 0.0 0.00 3.67
931 944 2.767644 TCCACCAGCTGGCTATACTA 57.232 50.000 33.06 8.5 40.39 1.82
1148 1161 0.529378 CTTCATGGCCTTCCTTGTGC 59.471 55.000 3.32 0.0 38.34 4.57
1266 1279 5.997746 CACAACTTCCTTTATCTTGTCCAGA 59.002 40.000 0.00 0.0 35.33 3.86
1409 1422 7.325725 ACCCATTACAGTTCTTAGGTAGTTT 57.674 36.000 0.00 0.0 0.00 2.66
1478 1492 6.604795 GCATCAGGATAATATTTGGGCAGTAT 59.395 38.462 0.00 0.0 0.00 2.12
1572 1586 7.384660 CAGATCTCAGCAAGAACTTATGATACC 59.615 40.741 0.00 0.0 35.09 2.73
1622 1636 4.067896 TCTCTGAATTTGTCTGAACCTGC 58.932 43.478 0.00 0.0 34.16 4.85
1804 1823 3.923461 GCAGTTATCGCCAGATCTATGTC 59.077 47.826 0.00 0.0 38.26 3.06
1983 2007 0.033504 CACCAACACTACTGGCTCGT 59.966 55.000 0.00 0.0 37.48 4.18
1992 2016 1.195442 TCATCGCCCCACCAACACTA 61.195 55.000 0.00 0.0 0.00 2.74
1997 2021 1.224315 CAGATCATCGCCCCACCAA 59.776 57.895 0.00 0.0 0.00 3.67


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.