Multiple sequence alignment - TraesCS6D01G300100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6D01G300100 chr6D 100.000 2602 0 0 1 2602 410084707 410087308 0 4806
1 TraesCS6D01G300100 chr6D 96.914 810 25 0 1793 2602 382014059 382013250 0 1358
2 TraesCS6D01G300100 chr6D 94.745 628 30 2 1 627 410105328 410105953 0 974
3 TraesCS6D01G300100 chr6D 91.625 597 44 6 64 656 368197176 368196582 0 821
4 TraesCS6D01G300100 chr4D 96.749 1138 37 0 654 1791 494026354 494027491 0 1897
5 TraesCS6D01G300100 chr4D 93.252 1141 68 6 657 1791 54409190 54408053 0 1672
6 TraesCS6D01G300100 chr3D 96.479 1136 35 2 657 1791 98497436 98498567 0 1871
7 TraesCS6D01G300100 chr3D 96.123 1135 43 1 657 1791 609330390 609329257 0 1851
8 TraesCS6D01G300100 chr3D 97.160 810 22 1 1793 2602 497665534 497664726 0 1367
9 TraesCS6D01G300100 chr3D 96.468 821 28 1 1783 2602 220654590 220655410 0 1354
10 TraesCS6D01G300100 chr3D 88.485 660 67 8 1 656 508854367 508853713 0 789
11 TraesCS6D01G300100 chr2D 96.300 1135 42 0 656 1790 43889896 43891030 0 1864
12 TraesCS6D01G300100 chr2D 97.044 812 24 0 1791 2602 159678267 159677456 0 1367
13 TraesCS6D01G300100 chr2D 96.917 811 25 0 1792 2602 469712648 469713458 0 1360
14 TraesCS6D01G300100 chr2D 91.874 603 42 6 56 656 164345213 164345810 0 835
15 TraesCS6D01G300100 chr2D 89.844 640 57 6 19 656 167587155 167586522 0 815
16 TraesCS6D01G300100 chr7D 95.936 1132 46 0 660 1791 497919307 497918176 0 1836
17 TraesCS6D01G300100 chr7D 97.407 810 21 0 1793 2602 436442988 436442179 0 1380
18 TraesCS6D01G300100 chr7D 97.287 811 22 0 1792 2602 627458041 627458851 0 1376
19 TraesCS6D01G300100 chr7D 89.564 642 55 12 19 656 77659115 77658482 0 804
20 TraesCS6D01G300100 chr5A 94.912 1140 56 2 653 1791 32051359 32050221 0 1783
21 TraesCS6D01G300100 chr1A 92.707 1138 73 6 661 1791 517188879 517190013 0 1633
22 TraesCS6D01G300100 chr5D 95.652 1012 41 1 657 1668 442964420 442965428 0 1622
23 TraesCS6D01G300100 chr5D 91.556 604 48 3 55 656 102174039 102173437 0 830
24 TraesCS6D01G300100 chr5D 89.259 661 61 9 1 656 297842639 297843294 0 819
25 TraesCS6D01G300100 chr1D 97.284 810 21 1 1793 2602 302987333 302988141 0 1373
26 TraesCS6D01G300100 chr1D 97.037 810 24 0 1793 2602 373297625 373298434 0 1363
27 TraesCS6D01G300100 chr1D 89.147 645 55 13 16 656 115561778 115562411 0 789
28 TraesCS6D01G300100 chr2B 88.041 1179 91 16 658 1791 57894284 57895457 0 1351


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6D01G300100 chr6D 410084707 410087308 2601 False 4806 4806 100.000 1 2602 1 chr6D.!!$F1 2601
1 TraesCS6D01G300100 chr6D 382013250 382014059 809 True 1358 1358 96.914 1793 2602 1 chr6D.!!$R2 809
2 TraesCS6D01G300100 chr6D 410105328 410105953 625 False 974 974 94.745 1 627 1 chr6D.!!$F2 626
3 TraesCS6D01G300100 chr6D 368196582 368197176 594 True 821 821 91.625 64 656 1 chr6D.!!$R1 592
4 TraesCS6D01G300100 chr4D 494026354 494027491 1137 False 1897 1897 96.749 654 1791 1 chr4D.!!$F1 1137
5 TraesCS6D01G300100 chr4D 54408053 54409190 1137 True 1672 1672 93.252 657 1791 1 chr4D.!!$R1 1134
6 TraesCS6D01G300100 chr3D 98497436 98498567 1131 False 1871 1871 96.479 657 1791 1 chr3D.!!$F1 1134
7 TraesCS6D01G300100 chr3D 609329257 609330390 1133 True 1851 1851 96.123 657 1791 1 chr3D.!!$R3 1134
8 TraesCS6D01G300100 chr3D 497664726 497665534 808 True 1367 1367 97.160 1793 2602 1 chr3D.!!$R1 809
9 TraesCS6D01G300100 chr3D 220654590 220655410 820 False 1354 1354 96.468 1783 2602 1 chr3D.!!$F2 819
10 TraesCS6D01G300100 chr3D 508853713 508854367 654 True 789 789 88.485 1 656 1 chr3D.!!$R2 655
11 TraesCS6D01G300100 chr2D 43889896 43891030 1134 False 1864 1864 96.300 656 1790 1 chr2D.!!$F1 1134
12 TraesCS6D01G300100 chr2D 159677456 159678267 811 True 1367 1367 97.044 1791 2602 1 chr2D.!!$R1 811
13 TraesCS6D01G300100 chr2D 469712648 469713458 810 False 1360 1360 96.917 1792 2602 1 chr2D.!!$F3 810
14 TraesCS6D01G300100 chr2D 164345213 164345810 597 False 835 835 91.874 56 656 1 chr2D.!!$F2 600
15 TraesCS6D01G300100 chr2D 167586522 167587155 633 True 815 815 89.844 19 656 1 chr2D.!!$R2 637
16 TraesCS6D01G300100 chr7D 497918176 497919307 1131 True 1836 1836 95.936 660 1791 1 chr7D.!!$R3 1131
17 TraesCS6D01G300100 chr7D 436442179 436442988 809 True 1380 1380 97.407 1793 2602 1 chr7D.!!$R2 809
18 TraesCS6D01G300100 chr7D 627458041 627458851 810 False 1376 1376 97.287 1792 2602 1 chr7D.!!$F1 810
19 TraesCS6D01G300100 chr7D 77658482 77659115 633 True 804 804 89.564 19 656 1 chr7D.!!$R1 637
20 TraesCS6D01G300100 chr5A 32050221 32051359 1138 True 1783 1783 94.912 653 1791 1 chr5A.!!$R1 1138
21 TraesCS6D01G300100 chr1A 517188879 517190013 1134 False 1633 1633 92.707 661 1791 1 chr1A.!!$F1 1130
22 TraesCS6D01G300100 chr5D 442964420 442965428 1008 False 1622 1622 95.652 657 1668 1 chr5D.!!$F2 1011
23 TraesCS6D01G300100 chr5D 102173437 102174039 602 True 830 830 91.556 55 656 1 chr5D.!!$R1 601
24 TraesCS6D01G300100 chr5D 297842639 297843294 655 False 819 819 89.259 1 656 1 chr5D.!!$F1 655
25 TraesCS6D01G300100 chr1D 302987333 302988141 808 False 1373 1373 97.284 1793 2602 1 chr1D.!!$F2 809
26 TraesCS6D01G300100 chr1D 373297625 373298434 809 False 1363 1363 97.037 1793 2602 1 chr1D.!!$F3 809
27 TraesCS6D01G300100 chr1D 115561778 115562411 633 False 789 789 89.147 16 656 1 chr1D.!!$F1 640
28 TraesCS6D01G300100 chr2B 57894284 57895457 1173 False 1351 1351 88.041 658 1791 1 chr2B.!!$F1 1133

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
597 608 0.457337 CTGATGCAAGCCCGCTTTTC 60.457 55.0 0.0 0.0 33.42 2.29 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1912 1974 0.606604 GTAGGTGCGAGGGACTTGAA 59.393 55.0 0.0 0.0 44.22 2.69 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
163 166 5.596836 AAGTTGCTCAGAAAAATCCAACA 57.403 34.783 0.00 0.00 36.08 3.33
177 180 5.659440 AATCCAACAAATCCAAATACGCT 57.341 34.783 0.00 0.00 0.00 5.07
274 277 1.562575 CGGAACCGGGAAAACACTCG 61.563 60.000 6.32 0.00 35.56 4.18
521 529 1.555967 TGATCATCCCGATATCGCCA 58.444 50.000 19.78 8.09 38.18 5.69
522 530 1.478105 TGATCATCCCGATATCGCCAG 59.522 52.381 19.78 10.25 38.18 4.85
525 534 1.691976 TCATCCCGATATCGCCAGTTT 59.308 47.619 19.78 0.00 38.18 2.66
549 558 6.117488 TCATTCTCTCATGCTTGCATTAGAA 58.883 36.000 16.89 17.84 0.00 2.10
597 608 0.457337 CTGATGCAAGCCCGCTTTTC 60.457 55.000 0.00 0.00 33.42 2.29
760 773 1.440938 TTTGGGTCGAACCGTTGCAG 61.441 55.000 16.31 0.00 39.83 4.41
810 823 1.935327 GACGCTAGAACTGACCGCCT 61.935 60.000 0.00 0.00 0.00 5.52
851 865 2.499205 CTAGCGAATCGGCACCCA 59.501 61.111 4.35 0.00 34.64 4.51
1098 1125 3.611025 AACCAGGTGATTTCCCTTGAA 57.389 42.857 0.00 0.00 0.00 2.69
1131 1158 3.245479 GGTTAGGGTTTCAGATTTGGGGA 60.245 47.826 0.00 0.00 0.00 4.81
1181 1208 6.151648 TGTTTTGATTTGGGCATTTTGTTTGA 59.848 30.769 0.00 0.00 0.00 2.69
1239 1266 2.130193 AGATTATCAGGGGCTTGAGCA 58.870 47.619 5.24 0.00 44.36 4.26
1366 1393 6.645415 CGGTATGAATTGTAGGGTGATAGTTC 59.355 42.308 0.00 0.00 0.00 3.01
1880 1942 7.295930 CGTAAGTATTTCCCTCAGTTTTTGAC 58.704 38.462 0.00 0.00 0.00 3.18
1912 1974 2.443781 TCCAGTAGGAGGCCACGT 59.556 61.111 5.01 2.16 39.61 4.49
1945 2007 5.753744 TCGCACCTACACAAACAAATAAAG 58.246 37.500 0.00 0.00 0.00 1.85
1979 2041 4.806640 ATGCAATAAAGGGGTTGTCAAG 57.193 40.909 0.00 0.00 0.00 3.02
2003 2065 1.774639 TCACGGTCACTTACGAAAGC 58.225 50.000 0.00 0.00 36.05 3.51
2191 2253 7.114095 AGTATTACGGTGGGTGAACAAATTAT 58.886 34.615 0.00 0.00 0.00 1.28
2353 2415 8.090831 CCAGCATGCATCTAGAGTATTAAGTTA 58.909 37.037 21.98 0.00 31.97 2.24
2392 2454 5.817296 ACGCTTTAAGCAAGATGACATGATA 59.183 36.000 17.51 0.00 42.58 2.15
2428 2490 9.592196 AAACTCATGCAATATGATATAAACCCT 57.408 29.630 0.00 0.00 0.00 4.34
2501 2563 0.761323 TCACTGGGAAAGGACACCGA 60.761 55.000 0.00 0.00 0.00 4.69
2553 2615 5.126545 TCCCATTGCAAGAAAGATCAATCTG 59.873 40.000 4.94 0.00 37.19 2.90
2557 2619 7.363181 CCATTGCAAGAAAGATCAATCTGGTAA 60.363 37.037 4.94 7.72 37.19 2.85
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
163 166 2.706890 ACGGACAGCGTATTTGGATTT 58.293 42.857 0.00 0.0 0.00 2.17
177 180 0.981183 ATCTGGCAGGTAAACGGACA 59.019 50.000 15.73 0.0 0.00 4.02
271 274 3.089784 CGGGAAATCAACCGCGAG 58.910 61.111 8.23 0.0 43.96 5.03
499 507 2.932614 GGCGATATCGGGATGATCAAAG 59.067 50.000 25.51 0.0 38.57 2.77
500 508 2.301583 TGGCGATATCGGGATGATCAAA 59.698 45.455 25.51 0.0 38.57 2.69
521 529 4.077108 TGCAAGCATGAGAGAATGAAACT 58.923 39.130 0.00 0.0 0.00 2.66
522 530 4.430137 TGCAAGCATGAGAGAATGAAAC 57.570 40.909 0.00 0.0 0.00 2.78
525 534 5.677567 TCTAATGCAAGCATGAGAGAATGA 58.322 37.500 16.39 0.0 38.61 2.57
549 558 6.209391 AGGAGCAAACAATAACAGTAGCAAAT 59.791 34.615 0.00 0.0 0.00 2.32
597 608 5.104900 AGGTAAGGTACAATGAGCAGGTTAG 60.105 44.000 0.00 0.0 0.00 2.34
737 750 1.153597 AACGGTTCGACCCAAACGTC 61.154 55.000 0.00 0.0 46.78 4.34
760 773 5.471257 AGAAATACGAAGATTAGCCCGATC 58.529 41.667 0.00 0.0 0.00 3.69
851 865 3.950254 CGTATCGAGCGAGCGGGT 61.950 66.667 6.34 0.0 0.00 5.28
893 907 1.679305 GGAGAGACAGAGCACGGGA 60.679 63.158 0.00 0.0 0.00 5.14
1098 1125 5.164897 TGAAACCCTAACCCTAAACCTAGT 58.835 41.667 0.00 0.0 0.00 2.57
1137 1164 7.550551 TCAAAACACAGCAAAATCAACCAAATA 59.449 29.630 0.00 0.0 0.00 1.40
1156 1183 6.151648 TCAAACAAAATGCCCAAATCAAAACA 59.848 30.769 0.00 0.0 0.00 2.83
1181 1208 1.299976 GGACCTGCCGAACCTCATT 59.700 57.895 0.00 0.0 0.00 2.57
1268 1295 0.326427 AGCCTCTCAGATGCCTTCCT 60.326 55.000 0.00 0.0 0.00 3.36
1512 1553 4.081406 TGATAGCAAGAACAATGCCACTT 58.919 39.130 0.00 0.0 44.91 3.16
1670 1731 6.451393 GTGCATCCCAACATAAAAGTAACAA 58.549 36.000 0.00 0.0 0.00 2.83
1880 1942 5.104527 TCCTACTGGATTGATACCTTGGTTG 60.105 44.000 0.00 0.0 37.46 3.77
1912 1974 0.606604 GTAGGTGCGAGGGACTTGAA 59.393 55.000 0.00 0.0 44.22 2.69
1979 2041 1.068748 TCGTAAGTGACCGTGAAGAGC 60.069 52.381 0.00 0.0 39.48 4.09
2191 2253 7.031372 GCTCAATTCTATCAATTGCTCAACAA 58.969 34.615 0.00 0.0 44.01 2.83
2353 2415 6.910972 GCTTAAAGCGTTACTCTGTTCTTTTT 59.089 34.615 0.00 0.0 0.00 1.94
2392 2454 8.829746 TCATATTGCATGAGTTTATCCCTCTAT 58.170 33.333 0.00 0.0 0.00 1.98
2428 2490 5.163353 TGTTGCCATCGAGGATAACAAGATA 60.163 40.000 13.86 0.0 40.64 1.98
2501 2563 4.588528 TGCTTAGCTTTGGGTTCAATCTTT 59.411 37.500 5.60 0.0 32.28 2.52
2553 2615 5.715434 TTATCAGTTTGGTTTGGCTTACC 57.285 39.130 2.20 2.2 36.17 2.85
2557 2619 4.764823 TCGAATTATCAGTTTGGTTTGGCT 59.235 37.500 0.00 0.0 0.00 4.75


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.