AutoCloner

Multiple sequence alignment - TraesCS6D01G297000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)

BLAST Results

Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

	qseqid	sseqid	percentage.identical	alignment.length	no.mismatch	no.gap.openings	qstart	qend	sstart	send	evalue	bitscore
0	TraesCS6D01G297000	chr6D	100.000	3788	0	0	1	3788	408181987	408185774	0.000000e+00	6996.0
1	TraesCS6D01G297000	chr6D	80.636	1446	229	35	1276	2701	408213422	408214836	0.000000e+00	1072.0
2	TraesCS6D01G297000	chr6D	89.655	87	9	0	2884	2970	450978453	450978367	1.110000e-20	111.0
3	TraesCS6D01G297000	chr6D	92.105	38	3	0	1300	1337	305075711	305075674	2.000000e-03	54.7
4	TraesCS6D01G297000	chr6B	93.674	1802	81	12	1005	2789	612847730	612849515	0.000000e+00	2665.0
5	TraesCS6D01G297000	chr6B	80.609	1444	224	33	1276	2698	612857372	612858780	0.000000e+00	1064.0
6	TraesCS6D01G297000	chr6B	82.696	549	62	15	2884	3427	18674381	18674901	1.240000e-124	457.0
7	TraesCS6D01G297000	chr6B	89.286	84	9	0	2797	2880	224901381	224901298	5.170000e-19	106.0
8	TraesCS6D01G297000	chr6B	88.235	85	10	0	2796	2880	685081234	685081318	6.690000e-18	102.0
9	TraesCS6D01G297000	chr6A	94.388	1568	79	4	1228	2792	553925942	553927503	0.000000e+00	2399.0
10	TraesCS6D01G297000	chr6A	80.014	1456	239	40	1276	2698	554302880	554304316	0.000000e+00	1029.0
11	TraesCS6D01G297000	chr6A	100.000	29	0	0	1300	1328	409796565	409796593	2.000000e-03	54.7
12	TraesCS6D01G297000	chr4A	86.601	918	100	12	2884	3788	64164028	64163121	0.000000e+00	992.0
13	TraesCS6D01G297000	chr4A	81.982	333	49	7	1285	1616	662110802	662110480	4.820000e-69	272.0
14	TraesCS6D01G297000	chr4A	79.358	218	37	6	1275	1488	710695508	710695295	3.050000e-31	147.0
15	TraesCS6D01G297000	chr3D	85.792	915	116	12	2882	3788	548214436	548213528	0.000000e+00	957.0
16	TraesCS6D01G297000	chr3D	85.512	918	114	13	2882	3788	548236531	548235622	0.000000e+00	941.0
17	TraesCS6D01G297000	chr5D	85.839	918	106	15	2884	3788	358827484	358828390	0.000000e+00	953.0
18	TraesCS6D01G297000	chr5D	90.110	546	34	4	2882	3427	503110966	503111491	0.000000e+00	691.0
19	TraesCS6D01G297000	chr4D	85.332	934	108	19	2869	3787	324257801	324256882	0.000000e+00	939.0
20	TraesCS6D01G297000	chr4D	91.360	544	28	3	2884	3427	207700557	207701081	0.000000e+00	726.0
21	TraesCS6D01G297000	chr4D	81.633	245	33	8	1277	1518	477911975	477912210	3.860000e-45	193.0
22	TraesCS6D01G297000	chr4D	77.966	177	34	4	587	760	423412748	423412922	5.170000e-19	106.0
23	TraesCS6D01G297000	chr7D	85.466	922	109	15	2879	3787	24437683	24436774	0.000000e+00	937.0
24	TraesCS6D01G297000	chr7D	85.435	920	98	22	2884	3788	378915096	378914198	0.000000e+00	924.0
25	TraesCS6D01G297000	chr7D	91.176	544	29	3	2884	3427	571074270	571074794	0.000000e+00	721.0
26	TraesCS6D01G297000	chr7D	74.307	397	85	13	508	892	112063298	112062907	6.550000e-33	152.0
27	TraesCS6D01G297000	chr2D	85.011	914	104	19	2883	3788	617721897	617722785	0.000000e+00	898.0
28	TraesCS6D01G297000	chr2D	79.412	170	28	7	544	708	139474830	139474663	3.090000e-21	113.0
29	TraesCS6D01G297000	chr2D	79.605	152	27	4	507	655	317599296	317599146	5.170000e-19	106.0
30	TraesCS6D01G297000	chr1B	88.252	715	68	9	3083	3788	253064713	253065420	0.000000e+00	841.0
31	TraesCS6D01G297000	chr2A	82.701	422	60	8	2884	3299	654735318	654734904	2.780000e-96	363.0
32	TraesCS6D01G297000	chr5A	82.521	349	54	6	2877	3220	653893681	653893335	2.210000e-77	300.0
33	TraesCS6D01G297000	chr5A	78.244	262	46	10	2403	2660	468871330	468871584	1.410000e-34	158.0
34	TraesCS6D01G297000	chr5A	78.138	247	44	10	2377	2618	533082993	533082752	8.480000e-32	148.0
35	TraesCS6D01G297000	chr4B	80.814	344	43	11	2884	3225	577213915	577214237	8.130000e-62	248.0
36	TraesCS6D01G297000	chr4B	72.637	402	88	16	498	888	447102279	447102669	3.090000e-21	113.0
37	TraesCS6D01G297000	chr4B	71.949	467	105	19	2158	2607	663656882	663657339	3.090000e-21	113.0
38	TraesCS6D01G297000	chr5B	80.352	341	52	6	2884	3217	586801535	586801203	1.050000e-60	244.0
39	TraesCS6D01G297000	chr5B	87.654	81	10	0	2800	2880	8937982	8938062	1.120000e-15	95.3
40	TraesCS6D01G297000	chr2B	74.265	544	120	17	2158	2691	18949379	18948846	1.070000e-50	211.0
41	TraesCS6D01G297000	chr2B	80.247	162	28	4	548	706	163430277	163430117	6.650000e-23	119.0
42	TraesCS6D01G297000	chr2B	88.235	85	10	0	2796	2880	697900640	697900724	6.690000e-18	102.0
43	TraesCS6D01G297000	chr2B	82.895	76	13	0	623	698	163567488	163567563	6.790000e-08	69.4
44	TraesCS6D01G297000	chr7A	79.724	217	38	5	1275	1488	27032927	27032714	6.550000e-33	152.0
45	TraesCS6D01G297000	chr7A	84.848	132	20	0	1275	1406	26978371	26978240	2.370000e-27	134.0
46	TraesCS6D01G297000	chr1D	76.444	225	45	8	506	725	68437277	68437498	8.600000e-22	115.0
47	TraesCS6D01G297000	chr1D	86.598	97	10	3	2875	2970	490559301	490559395	1.860000e-18	104.0
48	TraesCS6D01G297000	chr7B	73.243	370	74	17	555	904	692617560	692617924	1.110000e-20	111.0
49	TraesCS6D01G297000	chr7B	89.286	84	9	0	2797	2880	27012609	27012526	5.170000e-19	106.0
50	TraesCS6D01G297000	chr7B	78.313	166	34	2	508	671	693389208	693389373	5.170000e-19	106.0
51	TraesCS6D01G297000	chr7B	88.095	84	10	0	2797	2880	358413701	358413784	2.410000e-17	100.0
52	TraesCS6D01G297000	chr7B	89.610	77	8	0	2799	2875	88976498	88976422	8.660000e-17	99.0
53	TraesCS6D01G297000	chr7B	88.750	80	9	0	2801	2880	223664715	223664794	8.660000e-17	99.0
54	TraesCS6D01G297000	chr1A	83.333	120	15	5	2404	2522	130150345	130150460	5.170000e-19	106.0
55	TraesCS6D01G297000	chr1A	88.889	81	9	0	2800	2880	382098044	382097964	2.410000e-17	100.0
56	TraesCS6D01G297000	chr1A	93.023	43	2	1	795	837	550606875	550606834	1.140000e-05	62.1
57	TraesCS6D01G297000	chrUn	75.598	209	45	6	502	706	10779001	10778795	8.660000e-17	99.0

These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

	query	scaffold	start	end	length	rev.comp	avg.bitscore	max.bitscore	avg.percent.identical	query.start	query.end	num_hsp	groupid	homo_length
0	TraesCS6D01G297000	chr6D	408181987	408185774	3787	False	6996	6996	100.000	1	3788	1	chr6D.!!$F1	3787
1	TraesCS6D01G297000	chr6D	408213422	408214836	1414	False	1072	1072	80.636	1276	2701	1	chr6D.!!$F2	1425
2	TraesCS6D01G297000	chr6B	612847730	612849515	1785	False	2665	2665	93.674	1005	2789	1	chr6B.!!$F2	1784
3	TraesCS6D01G297000	chr6B	612857372	612858780	1408	False	1064	1064	80.609	1276	2698	1	chr6B.!!$F3	1422
4	TraesCS6D01G297000	chr6B	18674381	18674901	520	False	457	457	82.696	2884	3427	1	chr6B.!!$F1	543
5	TraesCS6D01G297000	chr6A	553925942	553927503	1561	False	2399	2399	94.388	1228	2792	1	chr6A.!!$F2	1564
6	TraesCS6D01G297000	chr6A	554302880	554304316	1436	False	1029	1029	80.014	1276	2698	1	chr6A.!!$F3	1422
7	TraesCS6D01G297000	chr4A	64163121	64164028	907	True	992	992	86.601	2884	3788	1	chr4A.!!$R1	904
8	TraesCS6D01G297000	chr3D	548213528	548214436	908	True	957	957	85.792	2882	3788	1	chr3D.!!$R1	906
9	TraesCS6D01G297000	chr3D	548235622	548236531	909	True	941	941	85.512	2882	3788	1	chr3D.!!$R2	906
10	TraesCS6D01G297000	chr5D	358827484	358828390	906	False	953	953	85.839	2884	3788	1	chr5D.!!$F1	904
11	TraesCS6D01G297000	chr5D	503110966	503111491	525	False	691	691	90.110	2882	3427	1	chr5D.!!$F2	545
12	TraesCS6D01G297000	chr4D	324256882	324257801	919	True	939	939	85.332	2869	3787	1	chr4D.!!$R1	918
13	TraesCS6D01G297000	chr4D	207700557	207701081	524	False	726	726	91.360	2884	3427	1	chr4D.!!$F1	543
14	TraesCS6D01G297000	chr7D	24436774	24437683	909	True	937	937	85.466	2879	3787	1	chr7D.!!$R1	908
15	TraesCS6D01G297000	chr7D	378914198	378915096	898	True	924	924	85.435	2884	3788	1	chr7D.!!$R3	904
16	TraesCS6D01G297000	chr7D	571074270	571074794	524	False	721	721	91.176	2884	3427	1	chr7D.!!$F1	543
17	TraesCS6D01G297000	chr2D	617721897	617722785	888	False	898	898	85.011	2883	3788	1	chr2D.!!$F1	905
18	TraesCS6D01G297000	chr1B	253064713	253065420	707	False	841	841	88.252	3083	3788	1	chr1B.!!$F1	705
19	TraesCS6D01G297000	chr2B	18948846	18949379	533	True	211	211	74.265	2158	2691	1	chr2B.!!$R1	533

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)

Position	MSA Position	Penalty	Sequence	TM	GC	Self any TH	Self end TH	Hairpin	End Stability	Orientation
938	939	0.030638	GCACACAACGACAAAGGCAT	59.969	50.0	0.0	0.0	0.0	4.4	F

Position	MSA Position	Penalty	Sequence	TM	GC	Self any TH	Self end TH	Hairpin	End Stability	Orientation
2797	2842	0.109723	ATGCTACCAAACACACCCGT	59.89	50.0	0.0	0.0	0.0	5.28	R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)

Show entries

Search:

Position	MSA Position	Penalty	Sequence	TM	GC	Self any TH	Self end TH	Hairpin	End Stability
36	37	9.685828	ATTTTGCAAATTTTTCTCAAATCCATG	57.314	25.926	13.65	0.00	0.00	3.66
37	38	8.447924	TTTGCAAATTTTTCTCAAATCCATGA	57.552	26.923	8.05	0.00	0.00	3.07
38	39	8.447924	TTGCAAATTTTTCTCAAATCCATGAA	57.552	26.923	0.00	0.00	0.00	2.57
39	40	7.863666	TGCAAATTTTTCTCAAATCCATGAAC	58.136	30.769	0.00	0.00	0.00	3.18
40	41	7.716123	TGCAAATTTTTCTCAAATCCATGAACT	59.284	29.630	0.00	0.00	0.00	3.01
41	42	8.562052	GCAAATTTTTCTCAAATCCATGAACTT	58.438	29.630	0.00	0.00	0.00	2.66
44	45	9.617523	AATTTTTCTCAAATCCATGAACTTTGT	57.382	25.926	0.00	0.00	32.89	2.83
45	46	8.647143	TTTTTCTCAAATCCATGAACTTTGTC	57.353	30.769	0.00	0.00	32.89	3.18
46	47	5.964958	TCTCAAATCCATGAACTTTGTCC	57.035	39.130	0.00	0.00	32.89	4.02
47	48	5.634118	TCTCAAATCCATGAACTTTGTCCT	58.366	37.500	0.00	0.00	32.89	3.85
48	49	6.070656	TCTCAAATCCATGAACTTTGTCCTT	58.929	36.000	0.00	0.00	32.89	3.36
49	50	6.550854	TCTCAAATCCATGAACTTTGTCCTTT	59.449	34.615	0.00	0.00	32.89	3.11
50	51	7.069826	TCTCAAATCCATGAACTTTGTCCTTTT	59.930	33.333	0.00	0.00	32.89	2.27
51	52	7.563906	TCAAATCCATGAACTTTGTCCTTTTT	58.436	30.769	0.00	0.00	32.89	1.94
92	93	9.890352	TTTTCTTTTTCCAAAAGTCAATTGTTG	57.110	25.926	5.13	2.54	0.00	3.33
93	94	8.839310	TTCTTTTTCCAAAAGTCAATTGTTGA	57.161	26.923	5.13	0.00	37.33	3.18
94	95	9.447157	TTCTTTTTCCAAAAGTCAATTGTTGAT	57.553	25.926	5.13	0.00	42.47	2.57
95	96	9.097257	TCTTTTTCCAAAAGTCAATTGTTGATC	57.903	29.630	5.13	0.00	42.47	2.92
96	97	7.462109	TTTTCCAAAAGTCAATTGTTGATCG	57.538	32.000	5.13	0.00	42.47	3.69
97	98	6.384258	TTCCAAAAGTCAATTGTTGATCGA	57.616	33.333	5.13	0.00	42.47	3.59
98	99	6.573664	TCCAAAAGTCAATTGTTGATCGAT	57.426	33.333	5.13	0.00	42.47	3.59
99	100	6.611381	TCCAAAAGTCAATTGTTGATCGATC	58.389	36.000	18.72	18.72	42.47	3.69
100	101	6.206438	TCCAAAAGTCAATTGTTGATCGATCA	59.794	34.615	23.99	23.99	42.47	2.92
101	102	6.862608	CCAAAAGTCAATTGTTGATCGATCAA	59.137	34.615	31.83	31.83	43.94	2.57
110	111	3.781079	TTGATCGATCAAATGGCCAAC	57.219	42.857	32.99	2.00	43.26	3.77

Showing 1 to 25 of 731 entries

Previous1 2 3 4 5…30Next

Show entries

Search:

Position	MSA Position	Penalty	Sequence	TM	GC	Self any TH	Self end TH	Hairpin	End Stability
10	11	9.685828	CATGGATTTGAGAAAAATTTGCAAAAT	57.314	25.926	17.19	4.62	32.91	1.82
11	12	8.900781	TCATGGATTTGAGAAAAATTTGCAAAA	58.099	25.926	17.19	0.00	32.91	2.44
12	13	8.447924	TCATGGATTTGAGAAAAATTTGCAAA	57.552	26.923	15.44	15.44	33.59	3.68
13	14	8.344098	GTTCATGGATTTGAGAAAAATTTGCAA	58.656	29.630	0.00	0.00	0.00	4.08
14	15	7.716123	AGTTCATGGATTTGAGAAAAATTTGCA	59.284	29.630	0.00	0.00	0.00	4.08
15	16	8.091385	AGTTCATGGATTTGAGAAAAATTTGC	57.909	30.769	0.00	0.00	0.00	3.68
18	19	9.617523	ACAAAGTTCATGGATTTGAGAAAAATT	57.382	25.926	18.71	0.00	37.37	1.82
19	20	9.264719	GACAAAGTTCATGGATTTGAGAAAAAT	57.735	29.630	18.71	0.00	37.37	1.82
20	21	7.710475	GGACAAAGTTCATGGATTTGAGAAAAA	59.290	33.333	18.71	0.00	37.37	1.94
21	22	7.069826	AGGACAAAGTTCATGGATTTGAGAAAA	59.930	33.333	18.71	0.00	37.37	2.29
22	23	6.550854	AGGACAAAGTTCATGGATTTGAGAAA	59.449	34.615	18.71	0.00	37.37	2.52
23	24	6.070656	AGGACAAAGTTCATGGATTTGAGAA	58.929	36.000	18.71	0.00	37.37	2.87
24	25	5.634118	AGGACAAAGTTCATGGATTTGAGA	58.366	37.500	18.71	0.00	37.37	3.27
25	26	5.972107	AGGACAAAGTTCATGGATTTGAG	57.028	39.130	18.71	3.69	37.37	3.02
26	27	6.729690	AAAGGACAAAGTTCATGGATTTGA	57.270	33.333	18.71	0.00	37.37	2.69
27	28	7.790823	AAAAAGGACAAAGTTCATGGATTTG	57.209	32.000	13.29	13.29	39.32	2.32
66	67	9.890352	CAACAATTGACTTTTGGAAAAAGAAAA	57.110	25.926	13.59	11.31	0.00	2.29
67	68	9.277783	TCAACAATTGACTTTTGGAAAAAGAAA	57.722	25.926	13.59	11.59	34.08	2.52
68	69	8.839310	TCAACAATTGACTTTTGGAAAAAGAA	57.161	26.923	13.59	4.75	34.08	2.52
69	70	9.097257	GATCAACAATTGACTTTTGGAAAAAGA	57.903	29.630	13.59	0.00	43.48	2.52
70	71	8.057742	CGATCAACAATTGACTTTTGGAAAAAG	58.942	33.333	13.59	10.21	43.48	2.27
71	72	7.761704	TCGATCAACAATTGACTTTTGGAAAAA	59.238	29.630	13.59	0.00	43.48	1.94
72	73	7.261325	TCGATCAACAATTGACTTTTGGAAAA	58.739	30.769	13.59	0.00	43.48	2.29
73	74	6.800543	TCGATCAACAATTGACTTTTGGAAA	58.199	32.000	13.59	0.00	43.48	3.13
74	75	6.384258	TCGATCAACAATTGACTTTTGGAA	57.616	33.333	13.59	0.00	43.48	3.53

Showing 1 to 25 of 764 entries

Previous1 2 3 4 5…31Next

Based at the University of Bristol with support from BBSRC.

AutoCloner maintained by Alex Coulton.