Multiple sequence alignment - TraesCS6D01G292100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6D01G292100 chr6D 100.000 2309 0 0 1 2309 402531207 402528899 0.000000e+00 4265
1 TraesCS6D01G292100 chr6D 98.833 1542 18 0 1 1542 392049939 392048398 0.000000e+00 2748
2 TraesCS6D01G292100 chr7D 99.351 1542 10 0 1 1542 23563082 23564623 0.000000e+00 2793
3 TraesCS6D01G292100 chr7D 99.287 1542 11 0 1 1542 135769093 135770634 0.000000e+00 2787
4 TraesCS6D01G292100 chr7D 99.157 1542 13 0 1 1542 400291676 400290135 0.000000e+00 2776
5 TraesCS6D01G292100 chr7D 99.092 1542 14 0 1 1542 135763962 135762421 0.000000e+00 2771
6 TraesCS6D01G292100 chr7D 99.027 1542 15 0 1 1542 14171011 14169470 0.000000e+00 2765
7 TraesCS6D01G292100 chr7D 89.704 777 66 12 1540 2309 569642070 569642839 0.000000e+00 979
8 TraesCS6D01G292100 chr3D 99.092 1542 14 0 1 1542 564344208 564345749 0.000000e+00 2771
9 TraesCS6D01G292100 chr3D 87.308 780 79 18 1540 2309 97353342 97352573 0.000000e+00 874
10 TraesCS6D01G292100 chr2D 99.027 1542 15 0 1 1542 70659368 70657827 0.000000e+00 2765
11 TraesCS6D01G292100 chr5D 98.833 1542 18 0 1 1542 460677991 460679532 0.000000e+00 2748
12 TraesCS6D01G292100 chr5D 85.935 775 90 18 1540 2306 415188054 415188817 0.000000e+00 809
13 TraesCS6D01G292100 chr7A 94.915 767 35 4 1545 2309 424892892 424893656 0.000000e+00 1197
14 TraesCS6D01G292100 chr7A 90.581 775 65 8 1540 2309 62538480 62539251 0.000000e+00 1020
15 TraesCS6D01G292100 chr2A 93.774 771 46 2 1540 2309 415114690 415113921 0.000000e+00 1157
16 TraesCS6D01G292100 chr7B 90.921 771 63 6 1544 2309 669007912 669007144 0.000000e+00 1029
17 TraesCS6D01G292100 chr1B 89.616 703 67 6 1610 2309 566905337 566904638 0.000000e+00 889
18 TraesCS6D01G292100 chr3A 85.347 778 91 22 1540 2306 151680530 151681295 0.000000e+00 784
19 TraesCS6D01G292100 chr1A 80.392 204 36 4 1342 1542 551824344 551824546 3.970000e-33 152


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6D01G292100 chr6D 402528899 402531207 2308 True 4265 4265 100.000 1 2309 1 chr6D.!!$R2 2308
1 TraesCS6D01G292100 chr6D 392048398 392049939 1541 True 2748 2748 98.833 1 1542 1 chr6D.!!$R1 1541
2 TraesCS6D01G292100 chr7D 23563082 23564623 1541 False 2793 2793 99.351 1 1542 1 chr7D.!!$F1 1541
3 TraesCS6D01G292100 chr7D 135769093 135770634 1541 False 2787 2787 99.287 1 1542 1 chr7D.!!$F2 1541
4 TraesCS6D01G292100 chr7D 400290135 400291676 1541 True 2776 2776 99.157 1 1542 1 chr7D.!!$R3 1541
5 TraesCS6D01G292100 chr7D 135762421 135763962 1541 True 2771 2771 99.092 1 1542 1 chr7D.!!$R2 1541
6 TraesCS6D01G292100 chr7D 14169470 14171011 1541 True 2765 2765 99.027 1 1542 1 chr7D.!!$R1 1541
7 TraesCS6D01G292100 chr7D 569642070 569642839 769 False 979 979 89.704 1540 2309 1 chr7D.!!$F3 769
8 TraesCS6D01G292100 chr3D 564344208 564345749 1541 False 2771 2771 99.092 1 1542 1 chr3D.!!$F1 1541
9 TraesCS6D01G292100 chr3D 97352573 97353342 769 True 874 874 87.308 1540 2309 1 chr3D.!!$R1 769
10 TraesCS6D01G292100 chr2D 70657827 70659368 1541 True 2765 2765 99.027 1 1542 1 chr2D.!!$R1 1541
11 TraesCS6D01G292100 chr5D 460677991 460679532 1541 False 2748 2748 98.833 1 1542 1 chr5D.!!$F2 1541
12 TraesCS6D01G292100 chr5D 415188054 415188817 763 False 809 809 85.935 1540 2306 1 chr5D.!!$F1 766
13 TraesCS6D01G292100 chr7A 424892892 424893656 764 False 1197 1197 94.915 1545 2309 1 chr7A.!!$F2 764
14 TraesCS6D01G292100 chr7A 62538480 62539251 771 False 1020 1020 90.581 1540 2309 1 chr7A.!!$F1 769
15 TraesCS6D01G292100 chr2A 415113921 415114690 769 True 1157 1157 93.774 1540 2309 1 chr2A.!!$R1 769
16 TraesCS6D01G292100 chr7B 669007144 669007912 768 True 1029 1029 90.921 1544 2309 1 chr7B.!!$R1 765
17 TraesCS6D01G292100 chr1B 566904638 566905337 699 True 889 889 89.616 1610 2309 1 chr1B.!!$R1 699
18 TraesCS6D01G292100 chr3A 151680530 151681295 765 False 784 784 85.347 1540 2306 1 chr3A.!!$F1 766

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
472 473 0.82541 TGGCATGGTCATTTGGCATC 59.175 50.0 0.0 0.0 42.67 3.91 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1716 1717 3.409851 TGATTTCAATGATGCTCGCAC 57.59 42.857 0.0 0.0 0.0 5.34 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
146 147 6.127423 TGTCATAGCCTGAACCTTACTCTTAC 60.127 42.308 0.00 0.00 35.07 2.34
180 181 3.114668 TCTTGCGGTAAAGCTGTTACA 57.885 42.857 15.81 0.00 38.13 2.41
393 394 1.189403 GAACTTCTACCGATGACGCG 58.811 55.000 3.53 3.53 38.29 6.01
472 473 0.825410 TGGCATGGTCATTTGGCATC 59.175 50.000 0.00 0.00 42.67 3.91
735 736 7.921786 TGACGAAAATAACCAGAATGAAGAT 57.078 32.000 0.00 0.00 39.69 2.40
1126 1127 2.346766 ACCTGTGACTGTTGCATCAA 57.653 45.000 0.00 0.00 0.00 2.57
1542 1543 1.623811 GAAATCATAGAGCCGGCCCTA 59.376 52.381 26.15 23.34 0.00 3.53
1574 1575 9.458374 GTGCTTAAAGTTTTGAAGTTATGCTTA 57.542 29.630 0.00 0.00 37.59 3.09
1689 1690 7.816513 GTGCTAGTCATATTCTTCATGATGCTA 59.183 37.037 0.00 0.00 35.02 3.49
2169 2186 3.243336 AGATCGTGTAGTTCGTTTGCTC 58.757 45.455 0.00 0.00 0.00 4.26
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
393 394 1.978542 TTGCGTCGCTCTTAGTCTTC 58.021 50.000 19.50 0.00 0.00 2.87
472 473 6.756074 ACCATGTTTACAGTGAACAAAATGTG 59.244 34.615 14.38 8.07 40.10 3.21
735 736 0.602638 CCACCTCACTTGCTTGCGTA 60.603 55.000 0.00 0.00 0.00 4.42
773 774 5.390145 GCAACATCAATCATCACCAAAAAGC 60.390 40.000 0.00 0.00 0.00 3.51
1126 1127 7.645058 TCAATTTTGAGAAACTCCTTTCAGT 57.355 32.000 0.00 0.00 38.67 3.41
1574 1575 5.509498 TCAACTAGCATAGGAAGGCAAAAT 58.491 37.500 0.00 0.00 44.97 1.82
1620 1621 5.624159 CCTATGCATAGGGATTTTGTGAGA 58.376 41.667 36.06 0.00 44.97 3.27
1716 1717 3.409851 TGATTTCAATGATGCTCGCAC 57.590 42.857 0.00 0.00 0.00 5.34
1719 1720 4.617223 GCATGATGATTTCAATGATGCTCG 59.383 41.667 0.00 0.00 38.03 5.03
1852 1857 7.148590 GCATATTTCCAACAAAAACCACATCTC 60.149 37.037 0.00 0.00 0.00 2.75
2169 2186 8.484641 TGATACTTGACATTAGAAAAGCTCTG 57.515 34.615 0.00 0.00 35.41 3.35


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.