Multiple sequence alignment - TraesCS6D01G261900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6D01G261900 chr6D 100.000 2342 0 0 1 2342 370022405 370024746 0 4325
1 TraesCS6D01G261900 chr6D 97.416 1161 27 2 1184 2342 369972796 369971637 0 1975
2 TraesCS6D01G261900 chr4D 96.949 2360 53 10 1 2342 123350009 123352367 0 3941
3 TraesCS6D01G261900 chr4D 96.147 2362 70 9 1 2342 134979311 134981671 0 3838
4 TraesCS6D01G261900 chr4D 95.966 2355 78 9 1 2342 240994887 240992537 0 3807
5 TraesCS6D01G261900 chr4D 97.508 1645 35 5 703 2342 123561662 123563305 0 2806
6 TraesCS6D01G261900 chr4D 94.479 1141 52 7 708 1846 450897577 450896446 0 1748
7 TraesCS6D01G261900 chr1D 96.800 2344 69 3 1 2342 269426861 269424522 0 3908
8 TraesCS6D01G261900 chr1D 96.684 1357 32 5 1 1344 185743874 185742518 0 2244
9 TraesCS6D01G261900 chr5D 96.438 2358 64 11 1 2342 301054288 301056641 0 3871
10 TraesCS6D01G261900 chr6A 94.023 2359 93 14 1 2342 79195837 79198164 0 3531
11 TraesCS6D01G261900 chr7B 96.978 1423 29 8 1 1410 742948850 742947429 0 2377
12 TraesCS6D01G261900 chr7A 96.972 1420 29 8 1 1407 60084824 60086242 0 2372
13 TraesCS6D01G261900 chr5A 96.901 1420 30 8 1 1407 16544442 16545860 0 2366
14 TraesCS6D01G261900 chr5A 96.761 1420 32 8 1 1407 420185590 420187008 0 2355
15 TraesCS6D01G261900 chr2A 96.761 1420 32 6 1 1407 755480437 755481855 0 2355
16 TraesCS6D01G261900 chr7D 98.357 1217 16 3 1129 2342 382029167 382027952 0 2134
17 TraesCS6D01G261900 chr7D 98.589 638 9 0 1 638 579041622 579042259 0 1129
18 TraesCS6D01G261900 chrUn 96.443 984 22 7 1 971 378556427 378557410 0 1611
19 TraesCS6D01G261900 chrUn 96.318 869 18 8 552 1407 417899047 417899914 0 1415


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6D01G261900 chr6D 370022405 370024746 2341 False 4325 4325 100.000 1 2342 1 chr6D.!!$F1 2341
1 TraesCS6D01G261900 chr6D 369971637 369972796 1159 True 1975 1975 97.416 1184 2342 1 chr6D.!!$R1 1158
2 TraesCS6D01G261900 chr4D 123350009 123352367 2358 False 3941 3941 96.949 1 2342 1 chr4D.!!$F1 2341
3 TraesCS6D01G261900 chr4D 134979311 134981671 2360 False 3838 3838 96.147 1 2342 1 chr4D.!!$F3 2341
4 TraesCS6D01G261900 chr4D 240992537 240994887 2350 True 3807 3807 95.966 1 2342 1 chr4D.!!$R1 2341
5 TraesCS6D01G261900 chr4D 123561662 123563305 1643 False 2806 2806 97.508 703 2342 1 chr4D.!!$F2 1639
6 TraesCS6D01G261900 chr4D 450896446 450897577 1131 True 1748 1748 94.479 708 1846 1 chr4D.!!$R2 1138
7 TraesCS6D01G261900 chr1D 269424522 269426861 2339 True 3908 3908 96.800 1 2342 1 chr1D.!!$R2 2341
8 TraesCS6D01G261900 chr1D 185742518 185743874 1356 True 2244 2244 96.684 1 1344 1 chr1D.!!$R1 1343
9 TraesCS6D01G261900 chr5D 301054288 301056641 2353 False 3871 3871 96.438 1 2342 1 chr5D.!!$F1 2341
10 TraesCS6D01G261900 chr6A 79195837 79198164 2327 False 3531 3531 94.023 1 2342 1 chr6A.!!$F1 2341
11 TraesCS6D01G261900 chr7B 742947429 742948850 1421 True 2377 2377 96.978 1 1410 1 chr7B.!!$R1 1409
12 TraesCS6D01G261900 chr7A 60084824 60086242 1418 False 2372 2372 96.972 1 1407 1 chr7A.!!$F1 1406
13 TraesCS6D01G261900 chr5A 16544442 16545860 1418 False 2366 2366 96.901 1 1407 1 chr5A.!!$F1 1406
14 TraesCS6D01G261900 chr5A 420185590 420187008 1418 False 2355 2355 96.761 1 1407 1 chr5A.!!$F2 1406
15 TraesCS6D01G261900 chr2A 755480437 755481855 1418 False 2355 2355 96.761 1 1407 1 chr2A.!!$F1 1406
16 TraesCS6D01G261900 chr7D 382027952 382029167 1215 True 2134 2134 98.357 1129 2342 1 chr7D.!!$R1 1213
17 TraesCS6D01G261900 chr7D 579041622 579042259 637 False 1129 1129 98.589 1 638 1 chr7D.!!$F1 637
18 TraesCS6D01G261900 chrUn 378556427 378557410 983 False 1611 1611 96.443 1 971 1 chrUn.!!$F1 970
19 TraesCS6D01G261900 chrUn 417899047 417899914 867 False 1415 1415 96.318 552 1407 1 chrUn.!!$F2 855

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
869 884 1.145738 GACGGACCCCCTACCTATACA 59.854 57.143 0.0 0.0 0.0 2.29 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1721 1746 2.371841 TCAGGGTGGCACCATATATCAC 59.628 50.0 35.69 17.08 41.02 3.06 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
238 239 5.057149 CCAGCTATTAACGTTGGCTTATCT 58.943 41.667 11.99 0.00 0.00 1.98
247 248 2.671351 CGTTGGCTTATCTGTCAGTCGT 60.671 50.000 0.00 0.00 0.00 4.34
442 443 6.489603 ACCACAATATGAACCACTTCCAATA 58.510 36.000 0.00 0.00 0.00 1.90
640 642 7.513660 GCTTCTTTAAAAGAAAGCACTTTGTCG 60.514 37.037 17.94 0.00 46.13 4.35
641 643 6.262601 TCTTTAAAAGAAAGCACTTTGTCGG 58.737 36.000 0.00 0.00 39.57 4.79
685 700 3.181475 CGCAGATGTAGGAAGAAGGCTTA 60.181 47.826 0.00 0.00 33.61 3.09
686 701 4.680708 CGCAGATGTAGGAAGAAGGCTTAA 60.681 45.833 0.00 0.00 33.61 1.85
844 859 3.996621 CCCACCCAGCCCCACAAT 61.997 66.667 0.00 0.00 0.00 2.71
869 884 1.145738 GACGGACCCCCTACCTATACA 59.854 57.143 0.00 0.00 0.00 2.29
910 925 8.451245 ACCTATACCTGATGATTTTCAATCCAT 58.549 33.333 0.00 0.00 0.00 3.41
1266 1283 2.071778 TTTTGGGCTTTGCTCTCACT 57.928 45.000 0.00 0.00 0.00 3.41
1477 1494 1.545841 GAAAAGGGGTGCTTCGGATT 58.454 50.000 0.00 0.00 0.00 3.01
1688 1713 3.713764 AGATCAGGTTAGGCAAGCACTAT 59.286 43.478 0.00 0.00 34.50 2.12
1738 1763 3.550820 TGTTGTGATATATGGTGCCACC 58.449 45.455 7.01 7.01 39.22 4.61
1852 1877 1.664956 AAACCTCCAAGGCAGGGGTT 61.665 55.000 12.68 12.68 39.63 4.11
2020 2045 1.898574 CCAACAACTTGAGGGCGCT 60.899 57.895 7.64 1.38 0.00 5.92
2125 2150 1.108776 ATGCTAAGGACGCCGTTCTA 58.891 50.000 0.00 0.00 0.00 2.10
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
191 192 6.539103 GGTCTAATTCCACGATAAAAGAGCTT 59.461 38.462 0.00 0.00 0.00 3.74
205 206 6.229936 ACGTTAATAGCTGGTCTAATTCCA 57.770 37.500 0.00 0.00 0.00 3.53
238 239 1.527611 AGACCCGACACGACTGACA 60.528 57.895 0.00 0.00 0.00 3.58
442 443 8.124199 GCATCAATCACAACAATTTGTTTTTCT 58.876 29.630 12.02 0.00 43.89 2.52
464 465 1.580845 AAGCCGTTGACAGCAGCATC 61.581 55.000 0.14 0.00 0.00 3.91
685 700 1.228154 GGGGTTCAGTTGGCGAGTT 60.228 57.895 0.00 0.00 0.00 3.01
686 701 1.990160 TTGGGGTTCAGTTGGCGAGT 61.990 55.000 0.00 0.00 0.00 4.18
813 828 1.639108 GGGTGGGGTATCCTGAACTTT 59.361 52.381 0.00 0.00 36.20 2.66
814 829 1.296002 GGGTGGGGTATCCTGAACTT 58.704 55.000 0.00 0.00 36.20 2.66
844 859 1.914764 GTAGGGGGTCCGTCAACCA 60.915 63.158 1.88 0.00 41.40 3.67
1477 1494 4.211920 CCTTTCAAAAGTGGTTACTCCCA 58.788 43.478 2.09 0.00 35.69 4.37
1721 1746 2.371841 TCAGGGTGGCACCATATATCAC 59.628 50.000 35.69 17.08 41.02 3.06
1738 1763 3.627577 CCGGTACCATTTCTTCAATCAGG 59.372 47.826 13.54 0.00 0.00 3.86
1852 1877 8.488668 TCATTTCTATTCATGAATGAGACCAGA 58.511 33.333 27.59 18.67 38.19 3.86
1953 1978 4.282496 AGAGTGGAAATCTACTGACGGAT 58.718 43.478 4.01 0.00 40.93 4.18
2125 2150 6.911308 ACTGGTATTTAATTGGAGCATACCT 58.089 36.000 10.24 0.00 40.05 3.08


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.