Multiple sequence alignment - TraesCS6D01G259300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6D01G259300 chr6D 100.000 2414 0 0 1 2414 365484653 365487066 0 4458
1 TraesCS6D01G259300 chr6D 95.835 2425 76 15 1 2413 54703036 54705447 0 3895
2 TraesCS6D01G259300 chr1D 96.116 2420 78 11 1 2414 299662352 299664761 0 3934
3 TraesCS6D01G259300 chr1D 95.955 2423 73 16 1 2414 8581797 8584203 0 3908
4 TraesCS6D01G259300 chr1D 95.752 1907 63 9 1 1897 25310237 25312135 0 3057
5 TraesCS6D01G259300 chr7D 95.962 2427 76 10 1 2414 26625191 26627608 0 3919
6 TraesCS6D01G259300 chr4D 95.937 2412 77 13 1 2403 449161428 449159029 0 3892
7 TraesCS6D01G259300 chr4D 95.340 2425 89 15 1 2414 5332457 5330046 0 3831
8 TraesCS6D01G259300 chr5D 95.496 2420 92 9 1 2414 551279239 551281647 0 3849
9 TraesCS6D01G259300 chr5D 95.415 2421 89 14 3 2414 408060058 408062465 0 3836
10 TraesCS6D01G259300 chr5D 95.926 1522 49 4 902 2414 21175205 21173688 0 2455


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6D01G259300 chr6D 365484653 365487066 2413 False 4458 4458 100.000 1 2414 1 chr6D.!!$F2 2413
1 TraesCS6D01G259300 chr6D 54703036 54705447 2411 False 3895 3895 95.835 1 2413 1 chr6D.!!$F1 2412
2 TraesCS6D01G259300 chr1D 299662352 299664761 2409 False 3934 3934 96.116 1 2414 1 chr1D.!!$F3 2413
3 TraesCS6D01G259300 chr1D 8581797 8584203 2406 False 3908 3908 95.955 1 2414 1 chr1D.!!$F1 2413
4 TraesCS6D01G259300 chr1D 25310237 25312135 1898 False 3057 3057 95.752 1 1897 1 chr1D.!!$F2 1896
5 TraesCS6D01G259300 chr7D 26625191 26627608 2417 False 3919 3919 95.962 1 2414 1 chr7D.!!$F1 2413
6 TraesCS6D01G259300 chr4D 449159029 449161428 2399 True 3892 3892 95.937 1 2403 1 chr4D.!!$R2 2402
7 TraesCS6D01G259300 chr4D 5330046 5332457 2411 True 3831 3831 95.340 1 2414 1 chr4D.!!$R1 2413
8 TraesCS6D01G259300 chr5D 551279239 551281647 2408 False 3849 3849 95.496 1 2414 1 chr5D.!!$F2 2413
9 TraesCS6D01G259300 chr5D 408060058 408062465 2407 False 3836 3836 95.415 3 2414 1 chr5D.!!$F1 2411
10 TraesCS6D01G259300 chr5D 21173688 21175205 1517 True 2455 2455 95.926 902 2414 1 chr5D.!!$R1 1512

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
81 82 0.111061 ACAGAAAGAGGTGGCATGCA 59.889 50.0 21.36 2.54 0.0 3.96 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1710 1745 1.742761 CGGTTCTGCATTGGATGAGT 58.257 50.0 0.0 0.0 0.0 3.41 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
78 79 2.307098 AGCTTACAGAAAGAGGTGGCAT 59.693 45.455 0.00 0.00 37.38 4.40
79 80 2.421424 GCTTACAGAAAGAGGTGGCATG 59.579 50.000 0.00 0.00 37.38 4.06
80 81 2.113860 TACAGAAAGAGGTGGCATGC 57.886 50.000 9.90 9.90 0.00 4.06
81 82 0.111061 ACAGAAAGAGGTGGCATGCA 59.889 50.000 21.36 2.54 0.00 3.96
249 251 0.389296 CGACGGTCAGTGCCACATTA 60.389 55.000 9.10 0.00 0.00 1.90
734 742 3.637273 GCCGTCCCCAGTTGACCT 61.637 66.667 0.00 0.00 0.00 3.85
770 778 0.452784 GGCAGCACTTAAACTTCGCG 60.453 55.000 0.00 0.00 0.00 5.87
813 822 1.585521 CGCGTGTACACTCCCGATC 60.586 63.158 23.01 3.56 0.00 3.69
1400 1420 0.766131 TACCCCATCAACAACACCGT 59.234 50.000 0.00 0.00 0.00 4.83
1671 1706 8.703604 TTTAGTCATAGGAAAAGATTGTCTCG 57.296 34.615 0.00 0.00 0.00 4.04
1755 1790 1.264749 CCATCGTCCTTCCCCTCACA 61.265 60.000 0.00 0.00 0.00 3.58
1805 1842 2.292851 CCCTCTCCTTCTCCTCCTTCTT 60.293 54.545 0.00 0.00 0.00 2.52
1926 1963 1.989966 GACTTCGTGGAGATCGCCGA 61.990 60.000 11.16 2.37 0.00 5.54
2121 2159 1.340248 GATGGAGCAGGCCAATTCATG 59.660 52.381 5.01 0.00 42.16 3.07
2136 2174 3.965258 ATGCAGCCCGTGGGACAA 61.965 61.111 9.72 0.00 44.16 3.18
2287 2325 1.080772 GACAGTGGTCGCGACATCA 60.081 57.895 37.26 25.28 33.68 3.07
2347 2385 0.595095 GTCTGAACGACGGTGGTACT 59.405 55.000 0.00 0.00 32.04 2.73
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
17 18 4.228210 TGGAATGCTGGTTCTCTTTCCTAT 59.772 41.667 0.00 0.00 37.39 2.57
18 19 3.587061 TGGAATGCTGGTTCTCTTTCCTA 59.413 43.478 0.00 0.00 37.39 2.94
122 123 3.806949 ATGCTTTTAGGTCTTCACCCA 57.193 42.857 0.00 0.00 45.12 4.51
357 359 4.536065 GATGTCGACAAAAACATGCTTCA 58.464 39.130 24.13 0.00 36.28 3.02
550 558 1.988406 AGCCCAACGACCCTAGGAC 60.988 63.158 11.48 2.93 0.00 3.85
552 560 2.291043 ACAGCCCAACGACCCTAGG 61.291 63.158 0.06 0.06 0.00 3.02
554 562 0.542467 TACACAGCCCAACGACCCTA 60.542 55.000 0.00 0.00 0.00 3.53
555 563 1.412453 TTACACAGCCCAACGACCCT 61.412 55.000 0.00 0.00 0.00 4.34
556 564 0.535553 TTTACACAGCCCAACGACCC 60.536 55.000 0.00 0.00 0.00 4.46
557 565 0.872388 CTTTACACAGCCCAACGACC 59.128 55.000 0.00 0.00 0.00 4.79
623 631 1.226974 GCAACATAGGCTCGCTCGA 60.227 57.895 0.00 0.00 0.00 4.04
726 734 3.048602 CCGTCGGTCAGGTCAACT 58.951 61.111 2.08 0.00 0.00 3.16
734 742 2.717044 CCCTATGTGCCGTCGGTCA 61.717 63.158 13.94 12.90 0.00 4.02
770 778 5.298276 TGGGAACTGTAGTGTGAATCAAAAC 59.702 40.000 0.00 0.00 0.00 2.43
1008 1024 3.076278 CGGTAGGTTGGCCCGGTA 61.076 66.667 0.00 0.00 38.09 4.02
1071 1091 1.901948 ACGAAGGGTGCTCTCGACA 60.902 57.895 3.35 0.00 0.00 4.35
1400 1420 2.596851 GCCCTTCACTGCTCCTCCA 61.597 63.158 0.00 0.00 0.00 3.86
1710 1745 1.742761 CGGTTCTGCATTGGATGAGT 58.257 50.000 0.00 0.00 0.00 3.41
1755 1790 2.094904 GCGGTTGTAATGGCGATGT 58.905 52.632 0.00 0.00 0.00 3.06
1926 1963 2.283529 ATCTTGACCTGGTCGCCGT 61.284 57.895 21.15 5.66 34.95 5.68
2287 2325 3.703127 GGAGAACGGCGGGGAAGT 61.703 66.667 13.24 0.00 0.00 3.01
2341 2379 6.415206 AGCTTACTCTAAACAACAGTACCA 57.585 37.500 0.00 0.00 0.00 3.25
2347 2385 4.103469 TGGGGAAGCTTACTCTAAACAACA 59.897 41.667 10.67 0.00 0.00 3.33


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.