Multiple sequence alignment - TraesCS6D01G241000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6D01G241000 chr6D 100.000 3110 0 0 1 3110 343521720 343524829 0.000000e+00 5744
1 TraesCS6D01G241000 chr7D 96.688 3110 84 10 1 3110 59692741 59689651 0.000000e+00 5155
2 TraesCS6D01G241000 chr5D 96.334 3110 112 2 1 3110 170710585 170713692 0.000000e+00 5110
3 TraesCS6D01G241000 chr2D 95.595 3110 93 9 1 3110 621171286 621168221 0.000000e+00 4944
4 TraesCS6D01G241000 chr3D 96.984 2885 77 7 235 3110 482587959 482590842 0.000000e+00 4837
5 TraesCS6D01G241000 chr6A 93.374 2807 142 14 244 3040 298324253 298327025 0.000000e+00 4113
6 TraesCS6D01G241000 chr6A 88.129 497 34 15 1216 1698 73682118 73681633 4.500000e-158 568
7 TraesCS6D01G241000 chr5B 96.277 1961 71 2 1151 3110 658347010 658348969 0.000000e+00 3216
8 TraesCS6D01G241000 chr5B 90.613 1044 84 5 1 1033 658345960 658347000 0.000000e+00 1373
9 TraesCS6D01G241000 chr6B 95.608 1958 81 3 1154 3110 651661136 651659183 0.000000e+00 3134
10 TraesCS6D01G241000 chr6B 90.732 1230 98 9 1 1218 396295844 396297069 0.000000e+00 1626
11 TraesCS6D01G241000 chr6B 90.134 1044 89 7 1 1033 651662189 651661149 0.000000e+00 1345
12 TraesCS6D01G241000 chr1B 95.406 1959 84 4 1154 3110 198113639 198111685 0.000000e+00 3114
13 TraesCS6D01G241000 chr1B 95.438 1951 84 5 1154 3103 149121724 149119778 0.000000e+00 3105
14 TraesCS6D01G241000 chr1B 90.298 1041 87 5 4 1033 149122774 149121737 0.000000e+00 1351
15 TraesCS6D01G241000 chr1B 90.134 1044 88 8 1 1033 198114691 198113652 0.000000e+00 1343
16 TraesCS6D01G241000 chr7B 92.395 1499 112 2 207 1704 241348024 241346527 0.000000e+00 2135
17 TraesCS6D01G241000 chr1A 91.301 1230 90 8 1 1218 365221022 365222246 0.000000e+00 1663
18 TraesCS6D01G241000 chr7A 87.185 437 45 4 792 1218 191902916 191903351 1.300000e-133 486


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6D01G241000 chr6D 343521720 343524829 3109 False 5744.0 5744 100.000 1 3110 1 chr6D.!!$F1 3109
1 TraesCS6D01G241000 chr7D 59689651 59692741 3090 True 5155.0 5155 96.688 1 3110 1 chr7D.!!$R1 3109
2 TraesCS6D01G241000 chr5D 170710585 170713692 3107 False 5110.0 5110 96.334 1 3110 1 chr5D.!!$F1 3109
3 TraesCS6D01G241000 chr2D 621168221 621171286 3065 True 4944.0 4944 95.595 1 3110 1 chr2D.!!$R1 3109
4 TraesCS6D01G241000 chr3D 482587959 482590842 2883 False 4837.0 4837 96.984 235 3110 1 chr3D.!!$F1 2875
5 TraesCS6D01G241000 chr6A 298324253 298327025 2772 False 4113.0 4113 93.374 244 3040 1 chr6A.!!$F1 2796
6 TraesCS6D01G241000 chr5B 658345960 658348969 3009 False 2294.5 3216 93.445 1 3110 2 chr5B.!!$F1 3109
7 TraesCS6D01G241000 chr6B 651659183 651662189 3006 True 2239.5 3134 92.871 1 3110 2 chr6B.!!$R1 3109
8 TraesCS6D01G241000 chr6B 396295844 396297069 1225 False 1626.0 1626 90.732 1 1218 1 chr6B.!!$F1 1217
9 TraesCS6D01G241000 chr1B 198111685 198114691 3006 True 2228.5 3114 92.770 1 3110 2 chr1B.!!$R2 3109
10 TraesCS6D01G241000 chr1B 149119778 149122774 2996 True 2228.0 3105 92.868 4 3103 2 chr1B.!!$R1 3099
11 TraesCS6D01G241000 chr7B 241346527 241348024 1497 True 2135.0 2135 92.395 207 1704 1 chr7B.!!$R1 1497
12 TraesCS6D01G241000 chr1A 365221022 365222246 1224 False 1663.0 1663 91.301 1 1218 1 chr1A.!!$F1 1217

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
528 529 0.320697 CCGACCGGTTTCTCTCCTTT 59.679 55.0 9.42 0.0 0.00 3.11 F
1389 1408 0.321122 CAGCTCCAGAAAGCCTTCGT 60.321 55.0 0.00 0.0 43.56 3.85 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1800 1829 0.176449 CATCGACTCCACCATCAGCA 59.824 55.000 0.0 0.0 0.00 4.41 R
3007 3041 1.462432 TGGGTGGTCCAGGTTGCTA 60.462 57.895 0.0 0.0 41.46 3.49 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
201 202 4.925054 CCATTAACAAGAACGACCTAACGA 59.075 41.667 0.00 0.00 37.03 3.85
225 226 4.299155 CACTTTCTTTGTCGTCTGCTAGA 58.701 43.478 0.00 0.00 0.00 2.43
373 374 4.927782 ACGCGCACACACACCCAT 62.928 61.111 5.73 0.00 0.00 4.00
528 529 0.320697 CCGACCGGTTTCTCTCCTTT 59.679 55.000 9.42 0.00 0.00 3.11
724 734 1.360551 CAACGGCGAGATCGAGGAT 59.639 57.895 16.62 0.00 43.02 3.24
1035 1054 0.608640 ACTCAAGTGTTAGCCCCGAG 59.391 55.000 0.00 0.00 0.00 4.63
1283 1302 4.483243 GGATCGGGGCTGCGGAAA 62.483 66.667 0.00 0.00 0.00 3.13
1389 1408 0.321122 CAGCTCCAGAAAGCCTTCGT 60.321 55.000 0.00 0.00 43.56 3.85
1451 1470 6.768861 ACTAGTTATGTGGTACAAGCAAAACA 59.231 34.615 0.00 0.00 44.16 2.83
1477 1496 7.222161 ACATTCATTAGCTAGCTCATCAATCA 58.778 34.615 23.26 0.00 0.00 2.57
1538 1557 7.388460 AGTGGACAGTAACATAGTAGTACAC 57.612 40.000 2.52 0.00 40.27 2.90
1809 1838 2.573869 CGTCTCGGTGCTGATGGT 59.426 61.111 0.00 0.00 0.00 3.55
1847 1876 0.456312 CGGCGAGTACAGGTTCAGAC 60.456 60.000 0.00 0.00 0.00 3.51
1863 1892 4.320546 TCAGACCATCCATGAATTGGTT 57.679 40.909 13.28 4.20 46.52 3.67
1864 1893 4.676109 TCAGACCATCCATGAATTGGTTT 58.324 39.130 13.28 7.10 46.52 3.27
2183 2213 1.243902 GCTTCAAACCCAATCCGTGA 58.756 50.000 0.00 0.00 0.00 4.35
2204 2234 6.703607 CGTGATTGCTCCTCTTAATCAACTAT 59.296 38.462 0.00 0.00 41.06 2.12
2369 2401 7.175104 AGGAGTTGGATAATGTGCTCTTTTTA 58.825 34.615 0.00 0.00 0.00 1.52
2439 2471 7.425224 AGTCCTTGCTATCAATTGTAGTAGT 57.575 36.000 5.13 0.00 0.00 2.73
2679 2713 3.695060 CACGGTTCCTTCTCTTAGAGCTA 59.305 47.826 4.03 0.00 0.00 3.32
2767 2801 2.762327 ACCCATCCATGCAAAATCTGTC 59.238 45.455 0.00 0.00 0.00 3.51
3007 3041 4.457496 CACAGGCGGCGTGGAGAT 62.457 66.667 24.48 2.83 0.00 2.75
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
58 59 2.165167 CCATCTGCTCTTTCTTTGCCA 58.835 47.619 0.00 0.00 0.00 4.92
201 202 1.940613 GCAGACGACAAAGAAAGTGGT 59.059 47.619 0.00 0.00 0.00 4.16
373 374 3.184628 ACAAGAGAGATGGGATCCAACA 58.815 45.455 15.23 3.27 36.95 3.33
528 529 4.779733 GGCGGGACTCTCCTGGGA 62.780 72.222 0.00 0.00 43.24 4.37
793 803 3.681835 GGCTGTGGAGACGACGGT 61.682 66.667 0.00 0.00 0.00 4.83
1035 1054 4.457257 AGAGAGGCAGTTAATTGAGCAAAC 59.543 41.667 1.56 0.00 0.00 2.93
1152 1171 7.147724 ACCATCAGAATCAAGCATCAATTCATT 60.148 33.333 0.00 0.00 32.92 2.57
1389 1408 4.506625 CCTTTTGATCCCTAACCTGTGACA 60.507 45.833 0.00 0.00 0.00 3.58
1451 1470 7.718314 TGATTGATGAGCTAGCTAATGAATGTT 59.282 33.333 26.24 8.28 0.00 2.71
1477 1496 4.951715 TGCATTGCATCCTTAATCTGAAGT 59.048 37.500 7.38 0.00 31.71 3.01
1538 1557 8.296713 ACATTTGCCTAAAAGTAACACTACATG 58.703 33.333 0.00 0.00 0.00 3.21
1800 1829 0.176449 CATCGACTCCACCATCAGCA 59.824 55.000 0.00 0.00 0.00 4.41
1809 1838 2.355445 GATGCTCGCCATCGACTCCA 62.355 60.000 0.00 0.00 40.84 3.86
1833 1862 2.902608 TGGATGGTCTGAACCTGTACT 58.097 47.619 0.00 0.00 46.60 2.73
2025 2054 6.108687 TCATGAAAGGAGTACAAGTAGCATG 58.891 40.000 0.00 0.00 0.00 4.06
2251 2281 2.426738 TGGACGCCCATCATCAAAATTC 59.573 45.455 0.00 0.00 37.58 2.17
2369 2401 3.059166 GCGTCCTTCATTTTGCAAACAT 58.941 40.909 12.39 6.23 0.00 2.71
2679 2713 4.980573 TCCAAAACCTGCTGTACAAGTAT 58.019 39.130 0.00 0.00 0.00 2.12
3007 3041 1.462432 TGGGTGGTCCAGGTTGCTA 60.462 57.895 0.00 0.00 41.46 3.49


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.