AutoCloner

Multiple sequence alignment - TraesCS6D01G239900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)

BLAST Results

Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

	qseqid	sseqid	percentage.identical	alignment.length	no.mismatch	no.gap.openings	qstart	qend	sstart	send	evalue	bitscore
0	TraesCS6D01G239900	chr6D	100.000	3515	0	0	1	3515	341081035	341077521	0.000000e+00	6492.0
1	TraesCS6D01G239900	chr6D	98.084	261	4	1	208	468	206587460	206587719	1.690000e-123	453.0
2	TraesCS6D01G239900	chr6D	96.958	263	8	0	207	469	421886354	421886092	3.670000e-120	442.0
3	TraesCS6D01G239900	chr6D	82.188	320	48	3	1216	1529	341079778	341079462	2.370000e-67	267.0
4	TraesCS6D01G239900	chr6D	82.188	320	48	3	1258	1574	341079820	341079507	2.370000e-67	267.0
5	TraesCS6D01G239900	chr6D	89.109	202	20	2	1	201	29358840	29359040	2.380000e-62	250.0
6	TraesCS6D01G239900	chr6D	88.462	208	23	1	1	207	42923287	42923494	2.380000e-62	250.0
7	TraesCS6D01G239900	chr6D	100.000	95	0	0	3902	3996	341077134	341077040	4.100000e-40	176.0
8	TraesCS6D01G239900	chr6D	92.553	94	5	2	3903	3994	351122682	351122775	2.510000e-27	134.0
9	TraesCS6D01G239900	chr6D	93.258	89	4	2	3903	3990	108237993	108238080	3.240000e-26	130.0
10	TraesCS6D01G239900	chr6A	94.454	2290	101	14	1216	3492	480806933	480804657	0.000000e+00	3502.0
11	TraesCS6D01G239900	chr6A	91.707	1025	66	7	557	1574	480807638	480806626	0.000000e+00	1404.0
12	TraesCS6D01G239900	chr6A	88.942	208	22	1	1	207	53440059	53440266	5.120000e-64	255.0
13	TraesCS6D01G239900	chr6A	80.678	295	42	6	1258	1549	480806975	480806693	8.700000e-52	215.0
14	TraesCS6D01G239900	chr6B	91.781	2336	123	31	1216	3492	479395833	479398158	0.000000e+00	3186.0
15	TraesCS6D01G239900	chr6B	92.241	1031	72	4	527	1550	479395060	479396089	0.000000e+00	1454.0
16	TraesCS6D01G239900	chr6B	81.717	361	52	6	1260	1613	479395754	479396107	5.050000e-74	289.0
17	TraesCS6D01G239900	chr6B	85.938	64	5	4	478	537	85791869	85791806	9.270000e-07	65.8
18	TraesCS6D01G239900	chr2D	85.105	1195	154	15	1607	2783	503436764	503437952	0.000000e+00	1199.0
19	TraesCS6D01G239900	chr2D	88.571	210	21	3	1	207	195143243	195143452	6.630000e-63	252.0
20	TraesCS6D01G239900	chr2D	90.385	52	3	2	477	528	324007023	324007072	2.580000e-07	67.6
21	TraesCS6D01G239900	chr2A	84.925	1194	156	15	1608	2783	649484367	649485554	0.000000e+00	1186.0
22	TraesCS6D01G239900	chr2B	84.393	1211	164	18	1590	2783	591912839	591914041	0.000000e+00	1166.0
23	TraesCS6D01G239900	chr1D	78.776	1013	178	31	1618	2608	269515939	269514942	0.000000e+00	645.0
24	TraesCS6D01G239900	chr1D	91.667	96	7	1	3902	3996	42825824	42825729	9.010000e-27	132.0
25	TraesCS6D01G239900	chr1B	78.692	1009	186	26	1618	2608	369512135	369513132	0.000000e+00	645.0
26	TraesCS6D01G239900	chr5A	76.936	1175	233	28	1608	2763	678181257	678180102	5.630000e-178	634.0
27	TraesCS6D01G239900	chr5A	94.318	264	15	0	205	468	85269767	85269504	4.810000e-109	405.0
28	TraesCS6D01G239900	chr4D	80.355	845	151	13	1766	2602	497697349	497698186	9.430000e-176	627.0
29	TraesCS6D01G239900	chr3D	96.958	263	8	0	206	468	599177326	599177588	3.670000e-120	442.0
30	TraesCS6D01G239900	chr3D	95.703	256	10	1	213	468	509752925	509753179	1.030000e-110	411.0
31	TraesCS6D01G239900	chr3D	93.407	91	5	1	3904	3993	382744280	382744370	2.510000e-27	134.0
32	TraesCS6D01G239900	chr3D	91.579	95	6	2	3903	3995	508410987	508410893	3.240000e-26	130.0
33	TraesCS6D01G239900	chr3D	91.489	94	6	2	3903	3994	507759307	507759400	1.170000e-25	128.0
34	TraesCS6D01G239900	chr3D	93.182	44	2	1	476	519	62792379	62792421	3.330000e-06	63.9
35	TraesCS6D01G239900	chr3D	91.489	47	1	2	477	522	430314192	430314236	1.200000e-05	62.1
36	TraesCS6D01G239900	chr7A	96.169	261	10	0	208	468	16122698	16122438	1.030000e-115	427.0
37	TraesCS6D01G239900	chr7A	95.076	264	13	0	206	469	578444492	578444755	2.220000e-112	416.0
38	TraesCS6D01G239900	chr7A	88.679	53	3	3	469	521	175253562	175253513	1.200000e-05	62.1
39	TraesCS6D01G239900	chr4A	94.297	263	15	0	208	470	185863005	185863267	1.730000e-108	403.0
40	TraesCS6D01G239900	chr4A	94.253	261	15	0	208	468	62950512	62950252	2.240000e-107	399.0
41	TraesCS6D01G239900	chr4A	88.462	208	23	1	1	207	91595967	91596174	2.380000e-62	250.0
42	TraesCS6D01G239900	chr4A	87.500	56	5	2	478	532	707072762	707072816	3.330000e-06	63.9
43	TraesCS6D01G239900	chr4A	93.182	44	0	3	479	522	432827749	432827709	1.200000e-05	62.1
44	TraesCS6D01G239900	chr3A	79.610	461	58	17	1496	1955	598409989	598410414	8.400000e-77	298.0
45	TraesCS6D01G239900	chr1A	89.151	212	20	3	1	210	558834738	558834528	1.100000e-65	261.0
46	TraesCS6D01G239900	chr7D	88.995	209	20	3	1	207	15836255	15836462	5.120000e-64	255.0
47	TraesCS6D01G239900	chr7D	88.152	211	24	1	1	210	564144970	564144760	2.380000e-62	250.0
48	TraesCS6D01G239900	chr7D	88.462	208	23	1	1	207	565041520	565041727	2.380000e-62	250.0
49	TraesCS6D01G239900	chr7D	91.489	94	5	3	3903	3994	608121654	608121746	4.190000e-25	126.0
50	TraesCS6D01G239900	chr5D	91.489	94	6	2	3903	3994	434573956	434574049	1.170000e-25	128.0
51	TraesCS6D01G239900	chr5D	91.489	94	6	2	3903	3994	544784982	544784889	1.170000e-25	128.0
52	TraesCS6D01G239900	chr3B	88.136	59	2	2	476	531	1219027	1219083	9.270000e-07	65.8
53	TraesCS6D01G239900	chr5B	95.122	41	1	1	477	517	173460893	173460932	3.330000e-06	63.9

These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

	query	scaffold	start	end	length	rev.comp	avg.bitscore	max.bitscore	avg.percent.identical	query.start	query.end	num_hsp	groupid	homo_length
0	TraesCS6D01G239900	chr6D	341077040	341081035	3995	True	1800.5	6492	91.094000	1	3996	4	chr6D.!!$R2	3995
1	TraesCS6D01G239900	chr6A	480804657	480807638	2981	True	1707.0	3502	88.946333	557	3492	3	chr6A.!!$R1	2935
2	TraesCS6D01G239900	chr6B	479395060	479398158	3098	False	1643.0	3186	88.579667	527	3492	3	chr6B.!!$F1	2965
3	TraesCS6D01G239900	chr2D	503436764	503437952	1188	False	1199.0	1199	85.105000	1607	2783	1	chr2D.!!$F3	1176
4	TraesCS6D01G239900	chr2A	649484367	649485554	1187	False	1186.0	1186	84.925000	1608	2783	1	chr2A.!!$F1	1175
5	TraesCS6D01G239900	chr2B	591912839	591914041	1202	False	1166.0	1166	84.393000	1590	2783	1	chr2B.!!$F1	1193
6	TraesCS6D01G239900	chr1D	269514942	269515939	997	True	645.0	645	78.776000	1618	2608	1	chr1D.!!$R2	990
7	TraesCS6D01G239900	chr1B	369512135	369513132	997	False	645.0	645	78.692000	1618	2608	1	chr1B.!!$F1	990
8	TraesCS6D01G239900	chr5A	678180102	678181257	1155	True	634.0	634	76.936000	1608	2763	1	chr5A.!!$R2	1155
9	TraesCS6D01G239900	chr4D	497697349	497698186	837	False	627.0	627	80.355000	1766	2602	1	chr4D.!!$F1	836

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)

Position	MSA Position	Penalty	Sequence	TM	GC	Self any TH	Self end TH	Hairpin	End Stability	Orientation
501	502	0.102663	TTGCAACGCATGGGCATATG	59.897	50.000	10.1	0.0	38.76	1.78	F
1105	1113	0.387202	CCCTCTCACCGCTCTGTATG	59.613	60.000	0.0	0.0	0.00	2.39	F
1203	1211	0.817634	CACACGTCACCACCCACAAT	60.818	55.000	0.0	0.0	0.00	2.71	F
2763	2885	1.743252	GCTCAAGAAGCCTGACCCG	60.743	63.158	0.0	0.0	45.92	5.28	F

Position	MSA Position	Penalty	Sequence	TM	GC	Self any TH	Self end TH	Hairpin	End Stability	Orientation
1971	2090	0.313987	CGATGTAGTATGGCTGCCGA	59.686	55.0	14.98	0.93	0.00	5.54	R
2824	2946	0.116940	ACCAACAATGCCCCAATCCT	59.883	50.0	0.00	0.00	0.00	3.24	R
2830	2952	0.687427	ATGGCTACCAACAATGCCCC	60.687	55.0	0.00	0.00	44.32	5.80	R
3948	4113	0.036952	AAGGACATGTGGAGAGCACG	60.037	55.0	1.15	0.00	0.00	5.34	R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)

Show entries

Search:

Position	MSA Position	Penalty	Sequence	TM	GC	Self any TH	Self end TH	Hairpin	End Stability
38	39	9.681062	AATACCTTAAAATCTCCTCGATTGAAA	57.319	29.630	0.00	0.00	41.42	2.69
39	40	7.617041	ACCTTAAAATCTCCTCGATTGAAAG	57.383	36.000	0.00	0.00	41.42	2.62
40	41	7.020914	CCTTAAAATCTCCTCGATTGAAAGG	57.979	40.000	11.01	11.01	42.40	3.11
41	42	6.823689	CCTTAAAATCTCCTCGATTGAAAGGA	59.176	38.462	15.97	0.00	46.03	3.36
42	43	7.336931	CCTTAAAATCTCCTCGATTGAAAGGAA	59.663	37.037	15.97	0.00	46.03	3.36
43	44	8.630054	TTAAAATCTCCTCGATTGAAAGGAAA	57.370	30.769	0.00	0.00	41.42	3.13
44	45	7.524717	AAAATCTCCTCGATTGAAAGGAAAA	57.475	32.000	0.00	0.00	41.42	2.29
45	46	6.749923	AATCTCCTCGATTGAAAGGAAAAG	57.250	37.500	0.00	0.00	41.09	2.27
46	47	5.228945	TCTCCTCGATTGAAAGGAAAAGT	57.771	39.130	0.00	0.00	41.09	2.66
47	48	5.621193	TCTCCTCGATTGAAAGGAAAAGTT	58.379	37.500	0.00	0.00	41.09	2.66
48	49	5.470098	TCTCCTCGATTGAAAGGAAAAGTTG	59.530	40.000	0.00	0.00	41.09	3.16
49	50	5.373222	TCCTCGATTGAAAGGAAAAGTTGA	58.627	37.500	0.00	0.00	38.74	3.18
50	51	6.003950	TCCTCGATTGAAAGGAAAAGTTGAT	58.996	36.000	0.00	0.00	38.74	2.57
51	52	6.490040	TCCTCGATTGAAAGGAAAAGTTGATT	59.510	34.615	0.00	0.00	38.74	2.57
52	53	6.583806	CCTCGATTGAAAGGAAAAGTTGATTG	59.416	38.462	0.00	0.00	34.35	2.67
53	54	7.270757	TCGATTGAAAGGAAAAGTTGATTGA	57.729	32.000	0.00	0.00	0.00	2.57
54	55	7.711846	TCGATTGAAAGGAAAAGTTGATTGAA	58.288	30.769	0.00	0.00	0.00	2.69
55	56	8.359642	TCGATTGAAAGGAAAAGTTGATTGAAT	58.640	29.630	0.00	0.00	0.00	2.57
56	57	9.624697	CGATTGAAAGGAAAAGTTGATTGAATA	57.375	29.630	0.00	0.00	0.00	1.75
67	68	8.962884	AAAGTTGATTGAATAATTTATGGGCC	57.037	30.769	0.00	0.00	0.00	5.80
68	69	7.919385	AGTTGATTGAATAATTTATGGGCCT	57.081	32.000	4.53	0.00	0.00	5.19
69	70	8.322905	AGTTGATTGAATAATTTATGGGCCTT	57.677	30.769	4.53	0.00	0.00	4.35
70	71	8.424133	AGTTGATTGAATAATTTATGGGCCTTC	58.576	33.333	4.53	0.00	0.00	3.46
71	72	8.424133	GTTGATTGAATAATTTATGGGCCTTCT	58.576	33.333	4.53	0.00	0.00	2.85
72	73	8.181904	TGATTGAATAATTTATGGGCCTTCTC	57.818	34.615	4.53	0.00	0.00	2.87

Showing 1 to 25 of 349 entries

Previous1 2 3 4 5…14Next

Show entries

Search:

Position	MSA Position	Penalty	Sequence	TM	GC	Self any TH	Self end TH	Hairpin	End Stability
12	13	9.681062	TTTCAATCGAGGAGATTTTAAGGTATT	57.319	29.630	0.00	0.00	46.80	1.89
13	14	9.331282	CTTTCAATCGAGGAGATTTTAAGGTAT	57.669	33.333	0.00	0.00	46.80	2.73
14	15	7.769044	CCTTTCAATCGAGGAGATTTTAAGGTA	59.231	37.037	15.50	0.00	46.80	3.08
15	16	6.599638	CCTTTCAATCGAGGAGATTTTAAGGT	59.400	38.462	15.50	0.00	46.80	3.50
16	17	6.823689	TCCTTTCAATCGAGGAGATTTTAAGG	59.176	38.462	16.62	16.62	46.80	2.69
17	18	7.849804	TCCTTTCAATCGAGGAGATTTTAAG	57.150	36.000	0.00	0.00	46.80	1.85
18	19	8.630054	TTTCCTTTCAATCGAGGAGATTTTAA	57.370	30.769	0.00	0.00	46.80	1.52
19	20	8.630054	TTTTCCTTTCAATCGAGGAGATTTTA	57.370	30.769	0.00	0.00	46.80	1.52
20	21	7.231519	ACTTTTCCTTTCAATCGAGGAGATTTT	59.768	33.333	0.00	0.00	46.80	1.82
21	22	6.717084	ACTTTTCCTTTCAATCGAGGAGATTT	59.283	34.615	0.00	0.00	46.80	2.17
23	24	5.810095	ACTTTTCCTTTCAATCGAGGAGAT	58.190	37.500	0.00	0.00	42.67	2.75
24	25	5.228945	ACTTTTCCTTTCAATCGAGGAGA	57.771	39.130	0.00	0.00	42.67	3.71
25	26	5.470098	TCAACTTTTCCTTTCAATCGAGGAG	59.530	40.000	0.00	0.00	42.67	3.69
26	27	5.373222	TCAACTTTTCCTTTCAATCGAGGA	58.627	37.500	0.00	0.00	40.22	3.71
27	28	5.689383	TCAACTTTTCCTTTCAATCGAGG	57.311	39.130	0.00	0.00	0.00	4.63
28	29	7.362662	TCAATCAACTTTTCCTTTCAATCGAG	58.637	34.615	0.00	0.00	0.00	4.04
29	30	7.270757	TCAATCAACTTTTCCTTTCAATCGA	57.729	32.000	0.00	0.00	0.00	3.59
30	31	7.928908	TTCAATCAACTTTTCCTTTCAATCG	57.071	32.000	0.00	0.00	0.00	3.34
41	42	9.394767	GGCCCATAAATTATTCAATCAACTTTT	57.605	29.630	0.00	0.00	0.00	2.27
42	43	8.771286	AGGCCCATAAATTATTCAATCAACTTT	58.229	29.630	0.00	0.00	0.00	2.66
43	44	8.322905	AGGCCCATAAATTATTCAATCAACTT	57.677	30.769	0.00	0.00	0.00	2.66
44	45	7.919385	AGGCCCATAAATTATTCAATCAACT	57.081	32.000	0.00	0.00	0.00	3.16
45	46	8.424133	AGAAGGCCCATAAATTATTCAATCAAC	58.576	33.333	0.00	0.00	0.00	3.18
46	47	8.551682	AGAAGGCCCATAAATTATTCAATCAA	57.448	30.769	0.00	0.00	0.00	2.57
47	48	7.233348	GGAGAAGGCCCATAAATTATTCAATCA	59.767	37.037	0.00	0.00	0.00	2.57

Showing 1 to 25 of 364 entries

Previous1 2 3 4 5…15Next

Based at the University of Bristol with support from BBSRC.

AutoCloner maintained by Alex Coulton.