Multiple sequence alignment - TraesCS6D01G233700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6D01G233700 chr6D 100.000 2636 0 0 1 2636 327605407 327602772 0 4868
1 TraesCS6D01G233700 chr1D 97.017 2648 65 3 3 2636 392033377 392036024 0 4440
2 TraesCS6D01G233700 chr1D 96.438 1825 45 9 3 1812 226938652 226936833 0 2992
3 TraesCS6D01G233700 chr1B 94.755 2650 121 7 3 2636 366884721 366882074 0 4108
4 TraesCS6D01G233700 chr7D 96.125 2245 73 4 3 2234 493556153 493553910 0 3651
5 TraesCS6D01G233700 chr7D 96.809 564 17 1 2073 2636 493553988 493553426 0 941
6 TraesCS6D01G233700 chrUn 95.722 2244 83 3 3 2234 132200801 132198559 0 3600
7 TraesCS6D01G233700 chrUn 95.745 564 24 0 2073 2636 132198637 132198074 0 909
8 TraesCS6D01G233700 chr6A 95.760 2099 73 5 551 2636 611909763 611911858 0 3369
9 TraesCS6D01G233700 chr3B 94.645 2166 98 8 1 2151 683358025 683355863 0 3341
10 TraesCS6D01G233700 chr3B 93.833 681 41 1 1956 2636 683355934 683355255 0 1024
11 TraesCS6D01G233700 chr7B 95.002 2041 82 9 3 2027 422979060 422977024 0 3186
12 TraesCS6D01G233700 chr7B 82.887 970 125 31 830 1777 381486640 381485690 0 833
13 TraesCS6D01G233700 chr5B 95.994 1922 61 5 3 1910 40989024 40990943 0 3109
14 TraesCS6D01G233700 chr5B 94.858 564 29 0 2073 2636 40991153 40991716 0 881
15 TraesCS6D01G233700 chr5B 94.947 475 22 2 2163 2636 551746201 551746674 0 743
16 TraesCS6D01G233700 chr5A 96.020 1809 53 8 3 1798 602717921 602719723 0 2924
17 TraesCS6D01G233700 chr4D 95.564 1781 64 4 3 1771 422950306 422948529 0 2837
18 TraesCS6D01G233700 chr3D 95.222 1800 69 6 3 1788 12149437 12147641 0 2832
19 TraesCS6D01G233700 chr3D 95.125 1805 71 6 3 1794 478114399 478116199 0 2830
20 TraesCS6D01G233700 chr3D 90.962 520 40 5 1638 2152 89550771 89551288 0 693
21 TraesCS6D01G233700 chr2B 93.676 1265 67 3 982 2234 223408070 223406807 0 1881
22 TraesCS6D01G233700 chr2B 95.035 564 28 0 2073 2636 223406885 223406322 0 887


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6D01G233700 chr6D 327602772 327605407 2635 True 4868.0 4868 100.0000 1 2636 1 chr6D.!!$R1 2635
1 TraesCS6D01G233700 chr1D 392033377 392036024 2647 False 4440.0 4440 97.0170 3 2636 1 chr1D.!!$F1 2633
2 TraesCS6D01G233700 chr1D 226936833 226938652 1819 True 2992.0 2992 96.4380 3 1812 1 chr1D.!!$R1 1809
3 TraesCS6D01G233700 chr1B 366882074 366884721 2647 True 4108.0 4108 94.7550 3 2636 1 chr1B.!!$R1 2633
4 TraesCS6D01G233700 chr7D 493553426 493556153 2727 True 2296.0 3651 96.4670 3 2636 2 chr7D.!!$R1 2633
5 TraesCS6D01G233700 chrUn 132198074 132200801 2727 True 2254.5 3600 95.7335 3 2636 2 chrUn.!!$R1 2633
6 TraesCS6D01G233700 chr6A 611909763 611911858 2095 False 3369.0 3369 95.7600 551 2636 1 chr6A.!!$F1 2085
7 TraesCS6D01G233700 chr3B 683355255 683358025 2770 True 2182.5 3341 94.2390 1 2636 2 chr3B.!!$R1 2635
8 TraesCS6D01G233700 chr7B 422977024 422979060 2036 True 3186.0 3186 95.0020 3 2027 1 chr7B.!!$R2 2024
9 TraesCS6D01G233700 chr7B 381485690 381486640 950 True 833.0 833 82.8870 830 1777 1 chr7B.!!$R1 947
10 TraesCS6D01G233700 chr5B 40989024 40991716 2692 False 1995.0 3109 95.4260 3 2636 2 chr5B.!!$F2 2633
11 TraesCS6D01G233700 chr5A 602717921 602719723 1802 False 2924.0 2924 96.0200 3 1798 1 chr5A.!!$F1 1795
12 TraesCS6D01G233700 chr4D 422948529 422950306 1777 True 2837.0 2837 95.5640 3 1771 1 chr4D.!!$R1 1768
13 TraesCS6D01G233700 chr3D 12147641 12149437 1796 True 2832.0 2832 95.2220 3 1788 1 chr3D.!!$R1 1785
14 TraesCS6D01G233700 chr3D 478114399 478116199 1800 False 2830.0 2830 95.1250 3 1794 1 chr3D.!!$F2 1791
15 TraesCS6D01G233700 chr3D 89550771 89551288 517 False 693.0 693 90.9620 1638 2152 1 chr3D.!!$F1 514
16 TraesCS6D01G233700 chr2B 223406322 223408070 1748 True 1384.0 1881 94.3555 982 2636 2 chr2B.!!$R1 1654

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
216 218 1.273606 CGGTGGAGTAGCATATGAGGG 59.726 57.143 6.97 0.0 0.0 4.30 F
585 587 1.609580 GGCACCGGACATCAACAGTTA 60.610 52.381 9.46 0.0 0.0 2.24 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1453 1490 0.109272 TCACGACGCTCTTCATCCAC 60.109 55.0 0.0 0.0 0.0 4.02 R
1868 1946 1.439679 CGGTAGGGTGCTCTGTTTTC 58.560 55.0 0.0 0.0 0.0 2.29 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
216 218 1.273606 CGGTGGAGTAGCATATGAGGG 59.726 57.143 6.97 0.00 0.00 4.30
497 499 6.016693 GGGAAGAAGAAGAAAGAAGAGGTTTG 60.017 42.308 0.00 0.00 0.00 2.93
585 587 1.609580 GGCACCGGACATCAACAGTTA 60.610 52.381 9.46 0.00 0.00 2.24
1188 1199 3.939740 TCATGGATGGAAGGAAGAAGG 57.060 47.619 0.00 0.00 0.00 3.46
1200 1211 5.926542 GGAAGGAAGAAGGTATTTTGTTTGC 59.073 40.000 0.00 0.00 0.00 3.68
1333 1358 7.012894 TGACACCACATTTCTTCTTTATTCGTT 59.987 33.333 0.00 0.00 0.00 3.85
1354 1391 5.116680 CGTTCTCCACTTTGTAAGTACTTCG 59.883 44.000 12.39 0.23 40.46 3.79
1453 1490 2.021355 AGAAGCATTTCAGAGAGGCG 57.979 50.000 0.00 0.00 35.70 5.52
1816 1893 4.119136 ACTATGTTTGTTTTGCTGTTGCC 58.881 39.130 0.00 0.00 38.71 4.52
1859 1937 7.770433 TGAAGTGATGAAGAAGAAAAACAGAGA 59.230 33.333 0.00 0.00 0.00 3.10
1868 1946 7.326968 AGAAGAAAAACAGAGAAAACAGAGG 57.673 36.000 0.00 0.00 0.00 3.69
1894 1975 3.702048 GCACCCTACCGCCAGTCA 61.702 66.667 0.00 0.00 0.00 3.41
1901 1982 0.465705 CTACCGCCAGTCATCATGGT 59.534 55.000 0.00 0.00 40.17 3.55
2109 2397 0.039035 AGCCGGCCACTAATTTTCCA 59.961 50.000 26.15 0.00 0.00 3.53
2352 2806 7.042725 ATCAATAACTGACCATCGTTCATTACG 60.043 37.037 0.00 0.00 43.79 3.18
2469 2923 4.139786 ACATAACTGATCCATGTCCATGC 58.860 43.478 1.64 0.00 37.49 4.06
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
180 182 1.135228 CACCGTATGTCATGTCGTCCA 60.135 52.381 0.00 0.00 0.00 4.02
216 218 4.162690 ATCGGGTCTTGAGGCGCC 62.163 66.667 21.89 21.89 0.00 6.53
232 234 0.244994 GTCTCTCGCACTGACACCAT 59.755 55.000 0.00 0.00 0.00 3.55
360 362 0.110486 AGCCCATGTCAACCTCGTTT 59.890 50.000 0.00 0.00 0.00 3.60
497 499 1.227383 GGTCATCCATGTCACCCCC 59.773 63.158 0.00 0.00 0.00 5.40
535 537 1.000283 TGGCCGCTACCAAATTGTTTG 60.000 47.619 0.00 0.00 36.55 2.93
585 587 1.651987 CGGCTCGTCACATTTACCAT 58.348 50.000 0.00 0.00 0.00 3.55
1188 1199 4.629634 GCATAGTTGGGGCAAACAAAATAC 59.370 41.667 5.28 0.00 32.21 1.89
1200 1211 1.336887 CGATCGTAGGCATAGTTGGGG 60.337 57.143 7.03 0.00 0.00 4.96
1333 1358 4.038282 TGCGAAGTACTTACAAAGTGGAGA 59.962 41.667 8.42 0.00 42.84 3.71
1354 1391 3.439476 GGCACATCTTGATCTATCCATGC 59.561 47.826 0.00 0.00 0.00 4.06
1453 1490 0.109272 TCACGACGCTCTTCATCCAC 60.109 55.000 0.00 0.00 0.00 4.02
1816 1893 5.006649 TCACTTCAAGACAAATCAAGTCACG 59.993 40.000 0.00 0.00 38.46 4.35
1859 1937 3.381590 GGTGCTCTGTTTTCCTCTGTTTT 59.618 43.478 0.00 0.00 0.00 2.43
1868 1946 1.439679 CGGTAGGGTGCTCTGTTTTC 58.560 55.000 0.00 0.00 0.00 2.29
1894 1975 5.612688 AGGTTTCATATCCTACCACCATGAT 59.387 40.000 0.00 0.00 33.02 2.45
1901 1982 4.202284 GCGGTAAGGTTTCATATCCTACCA 60.202 45.833 0.00 0.00 32.40 3.25
2013 2094 2.065470 TAGGATCCTACCGCCGAGCT 62.065 60.000 18.00 0.00 34.73 4.09
2147 2601 1.693606 ACAGAAAAATGGCCAACCCTG 59.306 47.619 10.96 15.17 33.59 4.45
2381 2835 2.737679 CGAATCGTTAGAAGGGGGACAC 60.738 54.545 0.00 0.00 0.00 3.67


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.