Multiple sequence alignment - TraesCS6D01G228500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6D01G228500 chr6D 100.000 2720 0 0 1 2720 319369105 319371824 0 5024
1 TraesCS6D01G228500 chr6D 97.432 2726 57 6 1 2720 134406244 134408962 0 4634
2 TraesCS6D01G228500 chr6D 97.208 2722 70 3 2 2720 371357879 371355161 0 4601
3 TraesCS6D01G228500 chr6D 97.140 2727 69 4 1 2720 297059250 297056526 0 4595
4 TraesCS6D01G228500 chr4D 97.286 2727 62 7 1 2720 180910917 180913638 0 4615
5 TraesCS6D01G228500 chr4D 97.214 2728 66 5 1 2720 65610075 65612800 0 4608
6 TraesCS6D01G228500 chr5D 97.252 2729 62 5 1 2720 234630603 234633327 0 4612
7 TraesCS6D01G228500 chr1D 97.212 2726 64 4 1 2720 94490457 94487738 0 4602
8 TraesCS6D01G228500 chr3D 97.142 2729 66 4 1 2720 234948420 234951145 0 4597
9 TraesCS6D01G228500 chr7D 97.106 2730 67 4 1 2720 301362879 301360152 0 4593


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6D01G228500 chr6D 319369105 319371824 2719 False 5024 5024 100.000 1 2720 1 chr6D.!!$F2 2719
1 TraesCS6D01G228500 chr6D 134406244 134408962 2718 False 4634 4634 97.432 1 2720 1 chr6D.!!$F1 2719
2 TraesCS6D01G228500 chr6D 371355161 371357879 2718 True 4601 4601 97.208 2 2720 1 chr6D.!!$R2 2718
3 TraesCS6D01G228500 chr6D 297056526 297059250 2724 True 4595 4595 97.140 1 2720 1 chr6D.!!$R1 2719
4 TraesCS6D01G228500 chr4D 180910917 180913638 2721 False 4615 4615 97.286 1 2720 1 chr4D.!!$F2 2719
5 TraesCS6D01G228500 chr4D 65610075 65612800 2725 False 4608 4608 97.214 1 2720 1 chr4D.!!$F1 2719
6 TraesCS6D01G228500 chr5D 234630603 234633327 2724 False 4612 4612 97.252 1 2720 1 chr5D.!!$F1 2719
7 TraesCS6D01G228500 chr1D 94487738 94490457 2719 True 4602 4602 97.212 1 2720 1 chr1D.!!$R1 2719
8 TraesCS6D01G228500 chr3D 234948420 234951145 2725 False 4597 4597 97.142 1 2720 1 chr3D.!!$F1 2719
9 TraesCS6D01G228500 chr7D 301360152 301362879 2727 True 4593 4593 97.106 1 2720 1 chr7D.!!$R1 2719

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
399 404 4.349636 TGGAGGTACCTTCTCAATGTTTCA 59.650 41.667 21.31 0.00 39.86 2.69 F
1056 1066 0.463116 AAGACACGCCGTTTGGTCTT 60.463 50.000 13.68 13.68 43.64 3.01 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1254 1264 1.291132 GGTAGACTTCTCCAATGCGC 58.709 55.0 0.00 0.0 0.00 6.09 R
2647 2675 1.827399 GCTGAAACTGTCCTCCCGGA 61.827 60.0 0.73 0.0 36.83 5.14 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
126 127 6.098409 GGTCCATCCAGAGTAAAGAGTGATTA 59.902 42.308 0.00 0.00 35.97 1.75
398 403 4.906618 TGGAGGTACCTTCTCAATGTTTC 58.093 43.478 21.31 1.36 39.86 2.78
399 404 4.349636 TGGAGGTACCTTCTCAATGTTTCA 59.650 41.667 21.31 0.00 39.86 2.69
612 622 4.797868 CGTTTCATGTTGCAGACTTTTCAA 59.202 37.500 0.00 0.00 0.00 2.69
960 970 7.363968 GCTTAAGCCCTAGAAAACTTCTCTCTA 60.364 40.741 17.00 0.00 36.80 2.43
1055 1065 0.878961 GAAGACACGCCGTTTGGTCT 60.879 55.000 3.18 3.18 42.08 3.85
1056 1066 0.463116 AAGACACGCCGTTTGGTCTT 60.463 50.000 13.68 13.68 43.64 3.01
1102 1112 5.815581 ACTTGAACATAGGAATACCAAGCA 58.184 37.500 0.00 0.00 38.94 3.91
1242 1252 2.044650 AAGAGCATGGCCGCACAT 60.045 55.556 5.37 0.00 0.00 3.21
1254 1264 2.327343 CGCACATATCGCCATGGGG 61.327 63.158 22.46 22.46 29.50 4.96
1410 1420 0.674534 ATATCCGACGCCAGGAGAAC 59.325 55.000 0.00 0.00 41.66 3.01
2206 2234 4.866088 CGTTTTGCCGCACATCAT 57.134 50.000 0.00 0.00 0.00 2.45
2567 2595 3.228188 TGATTGAAGGGAAGCAACAGT 57.772 42.857 0.00 0.00 0.00 3.55
2569 2597 4.724399 TGATTGAAGGGAAGCAACAGTAA 58.276 39.130 0.00 0.00 0.00 2.24
2590 2618 4.664150 AATTGAAAACCGCAAGAGGAAA 57.336 36.364 0.00 0.00 43.02 3.13
2632 2660 4.811364 GGAGCCCAGCAGAAGCCC 62.811 72.222 0.00 0.00 43.56 5.19
2647 2675 1.149854 GCCCCGATTTACCCCGAAT 59.850 57.895 0.00 0.00 0.00 3.34
2705 2733 0.814457 TTCGCACAACCATAATGGCC 59.186 50.000 0.00 0.00 42.67 5.36
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
126 127 4.202264 ACCGAGACACAGTCTTTCAGAAAT 60.202 41.667 0.70 0.00 43.53 2.17
342 347 7.069826 CCCAATTAAGTGTCATCATTAACCCAT 59.930 37.037 1.80 0.00 0.00 4.00
517 527 8.743085 ACACATAGAGAGCAATGAACAATAAT 57.257 30.769 0.00 0.00 0.00 1.28
518 528 8.565896 AACACATAGAGAGCAATGAACAATAA 57.434 30.769 0.00 0.00 0.00 1.40
519 529 9.098355 GTAACACATAGAGAGCAATGAACAATA 57.902 33.333 0.00 0.00 0.00 1.90
612 622 2.521105 AAAGCACCTTACTCGTCGTT 57.479 45.000 0.00 0.00 0.00 3.85
960 970 2.192263 GGAGAGGGGTCAGAAATGAGT 58.808 52.381 0.00 0.00 0.00 3.41
1055 1065 5.200483 ACTTGGTGACTTCCTTCAAATGAA 58.800 37.500 0.00 0.00 0.00 2.57
1056 1066 4.792068 ACTTGGTGACTTCCTTCAAATGA 58.208 39.130 0.00 0.00 0.00 2.57
1102 1112 0.390735 GCGTTGTAGGTTCCGGTGAT 60.391 55.000 0.00 0.00 0.00 3.06
1254 1264 1.291132 GGTAGACTTCTCCAATGCGC 58.709 55.000 0.00 0.00 0.00 6.09
1323 1333 3.524789 TGGTCTTGATCATCTCCCATTGT 59.475 43.478 0.00 0.00 0.00 2.71
1410 1420 1.300971 CCTTGTCCGTGCACATCTGG 61.301 60.000 18.64 9.99 0.00 3.86
1579 1589 2.502213 TCGTCGACTTCTGCTTTTGA 57.498 45.000 14.70 0.00 0.00 2.69
1992 2008 4.377431 GGTTCTGAACTAACACTTGCATCG 60.377 45.833 19.05 0.00 0.00 3.84
2206 2234 1.913951 ATGCTGCGGGTCCATCAAGA 61.914 55.000 0.00 0.00 0.00 3.02
2386 2414 4.567159 GCTAACTTACTGAAATCCTCCACG 59.433 45.833 0.00 0.00 0.00 4.94
2567 2595 5.776173 TTCCTCTTGCGGTTTTCAATTTA 57.224 34.783 0.00 0.00 0.00 1.40
2569 2597 4.664150 TTTCCTCTTGCGGTTTTCAATT 57.336 36.364 0.00 0.00 0.00 2.32
2590 2618 7.056635 CAGAATTGTACTTCCCTTGTCCATAT 58.943 38.462 0.00 0.00 0.00 1.78
2632 2660 2.908817 CGGATTCGGGGTAAATCGG 58.091 57.895 0.00 0.00 34.58 4.18
2647 2675 1.827399 GCTGAAACTGTCCTCCCGGA 61.827 60.000 0.73 0.00 36.83 5.14


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.