Multiple sequence alignment - TraesCS6D01G210600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6D01G210600 chr6D 100.000 2267 0 0 1 2267 297171464 297169198 0.000000e+00 4187
1 TraesCS6D01G210600 chr6D 94.347 2282 75 21 1 2267 446364380 446362138 0.000000e+00 3450
2 TraesCS6D01G210600 chr5D 95.068 2291 71 10 1 2267 384512084 384509812 0.000000e+00 3567
3 TraesCS6D01G210600 chr5D 94.917 2302 76 13 1 2267 29767653 29765358 0.000000e+00 3565
4 TraesCS6D01G210600 chr5D 95.202 1605 54 10 685 2267 140952538 140950935 0.000000e+00 2516
5 TraesCS6D01G210600 chr3A 93.827 2284 99 16 1 2267 702240704 702242962 0.000000e+00 3398
6 TraesCS6D01G210600 chr7D 93.664 1973 86 9 1 1968 103541445 103543383 0.000000e+00 2915
7 TraesCS6D01G210600 chr7D 95.904 1587 54 3 1 1577 79226624 79228209 0.000000e+00 2560
8 TraesCS6D01G210600 chr5A 92.004 2051 113 28 226 2267 178860401 178858393 0.000000e+00 2832
9 TraesCS6D01G210600 chr2D 95.250 1579 55 9 1 1577 239256901 239258461 0.000000e+00 2483
10 TraesCS6D01G210600 chr4A 94.811 1426 62 10 1 1419 433607489 433606069 0.000000e+00 2213
11 TraesCS6D01G210600 chr4A 94.913 1376 69 1 1 1375 192323385 192322010 0.000000e+00 2152
12 TraesCS6D01G210600 chr7A 92.520 1377 66 20 901 2267 56074799 56076148 0.000000e+00 1938
13 TraesCS6D01G210600 chr2A 92.157 1377 56 25 901 2267 610790142 610791476 0.000000e+00 1897
14 TraesCS6D01G210600 chr2A 96.263 883 33 0 3 885 610789278 610790160 0.000000e+00 1448
15 TraesCS6D01G210600 chr2A 92.990 699 41 6 1572 2267 442545695 442545002 0.000000e+00 1013
16 TraesCS6D01G210600 chr4D 96.275 886 33 0 3 888 236672621 236671736 0.000000e+00 1454
17 TraesCS6D01G210600 chr5B 95.951 889 36 0 1 889 56336255 56337143 0.000000e+00 1443
18 TraesCS6D01G210600 chr1D 95.833 888 37 0 1 888 463793609 463792722 0.000000e+00 1435
19 TraesCS6D01G210600 chr7B 90.271 812 54 11 1464 2267 551236441 551237235 0.000000e+00 1038
20 TraesCS6D01G210600 chr3B 82.895 228 10 14 1407 1630 318305171 318305373 6.430000e-41 178


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6D01G210600 chr6D 297169198 297171464 2266 True 4187.0 4187 100.000 1 2267 1 chr6D.!!$R1 2266
1 TraesCS6D01G210600 chr6D 446362138 446364380 2242 True 3450.0 3450 94.347 1 2267 1 chr6D.!!$R2 2266
2 TraesCS6D01G210600 chr5D 384509812 384512084 2272 True 3567.0 3567 95.068 1 2267 1 chr5D.!!$R3 2266
3 TraesCS6D01G210600 chr5D 29765358 29767653 2295 True 3565.0 3565 94.917 1 2267 1 chr5D.!!$R1 2266
4 TraesCS6D01G210600 chr5D 140950935 140952538 1603 True 2516.0 2516 95.202 685 2267 1 chr5D.!!$R2 1582
5 TraesCS6D01G210600 chr3A 702240704 702242962 2258 False 3398.0 3398 93.827 1 2267 1 chr3A.!!$F1 2266
6 TraesCS6D01G210600 chr7D 103541445 103543383 1938 False 2915.0 2915 93.664 1 1968 1 chr7D.!!$F2 1967
7 TraesCS6D01G210600 chr7D 79226624 79228209 1585 False 2560.0 2560 95.904 1 1577 1 chr7D.!!$F1 1576
8 TraesCS6D01G210600 chr5A 178858393 178860401 2008 True 2832.0 2832 92.004 226 2267 1 chr5A.!!$R1 2041
9 TraesCS6D01G210600 chr2D 239256901 239258461 1560 False 2483.0 2483 95.250 1 1577 1 chr2D.!!$F1 1576
10 TraesCS6D01G210600 chr4A 433606069 433607489 1420 True 2213.0 2213 94.811 1 1419 1 chr4A.!!$R2 1418
11 TraesCS6D01G210600 chr4A 192322010 192323385 1375 True 2152.0 2152 94.913 1 1375 1 chr4A.!!$R1 1374
12 TraesCS6D01G210600 chr7A 56074799 56076148 1349 False 1938.0 1938 92.520 901 2267 1 chr7A.!!$F1 1366
13 TraesCS6D01G210600 chr2A 610789278 610791476 2198 False 1672.5 1897 94.210 3 2267 2 chr2A.!!$F1 2264
14 TraesCS6D01G210600 chr2A 442545002 442545695 693 True 1013.0 1013 92.990 1572 2267 1 chr2A.!!$R1 695
15 TraesCS6D01G210600 chr4D 236671736 236672621 885 True 1454.0 1454 96.275 3 888 1 chr4D.!!$R1 885
16 TraesCS6D01G210600 chr5B 56336255 56337143 888 False 1443.0 1443 95.951 1 889 1 chr5B.!!$F1 888
17 TraesCS6D01G210600 chr1D 463792722 463793609 887 True 1435.0 1435 95.833 1 888 1 chr1D.!!$R1 887
18 TraesCS6D01G210600 chr7B 551236441 551237235 794 False 1038.0 1038 90.271 1464 2267 1 chr7B.!!$F1 803

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
710 742 1.668101 GATCGGCTCACTCGGGAAGT 61.668 60.0 0.0 0.0 39.44 3.01 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2081 2243 1.469251 GCAAGCTGATGTGGCAGAATG 60.469 52.381 0.0 0.0 38.14 2.67 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
28 29 3.538614 GCTCCGGTGCCAGATCTA 58.461 61.111 17.73 0.00 0.00 1.98
100 101 4.335315 CACAAGGTTTGTCTCTGCTTTGTA 59.665 41.667 0.00 0.00 43.23 2.41
153 154 2.864946 GTGCTAGATCATGCTGACAGTG 59.135 50.000 3.99 0.00 0.00 3.66
260 261 2.129607 CAGCACACATTTTTGCCACTC 58.870 47.619 0.00 0.00 39.75 3.51
449 450 3.431725 CGGGTTTTCGGAGCCAGC 61.432 66.667 4.08 0.00 37.01 4.85
450 451 2.034221 GGGTTTTCGGAGCCAGCT 59.966 61.111 0.00 0.00 37.16 4.24
505 506 2.299582 CCATGCCCTGTTTGATTCACAA 59.700 45.455 0.00 0.00 36.65 3.33
518 539 6.462552 TTGATTCACAACCAACTTTGATGA 57.537 33.333 0.00 0.00 33.18 2.92
710 742 1.668101 GATCGGCTCACTCGGGAAGT 61.668 60.000 0.00 0.00 39.44 3.01
1028 1096 4.125695 GAAGGACGCGCCGGTACT 62.126 66.667 5.73 0.00 43.43 2.73
1181 1249 1.071299 TGGCTGCTCATGTTCGTGT 59.929 52.632 0.00 0.00 0.00 4.49
1264 1332 2.360165 GCAATCAAGATGAAGGCGGAAT 59.640 45.455 0.00 0.00 0.00 3.01
1536 1680 0.890996 CCTGGGAGCACTTGTGAACC 60.891 60.000 4.79 6.54 0.00 3.62
1932 2087 2.999185 AGGCTCCATTCCCAGAAAAA 57.001 45.000 0.00 0.00 0.00 1.94
1933 2088 3.479866 AGGCTCCATTCCCAGAAAAAT 57.520 42.857 0.00 0.00 0.00 1.82
1934 2089 4.608170 AGGCTCCATTCCCAGAAAAATA 57.392 40.909 0.00 0.00 0.00 1.40
2020 2182 1.481772 GCTGAATTATTGGGCTTGGCA 59.518 47.619 0.00 0.00 0.00 4.92
2151 2313 6.430451 CGGATTGCTAGTGACCAAAATAATC 58.570 40.000 0.00 0.00 0.00 1.75
2210 2376 5.420409 GTCTACGACCATTCCAGAAGAAAT 58.580 41.667 0.00 0.00 38.21 2.17
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
11 12 0.530870 GTTAGATCTGGCACCGGAGC 60.531 60.000 16.31 16.31 37.95 4.70
28 29 1.176527 CTTGCCATTCACCATCCGTT 58.823 50.000 0.00 0.00 0.00 4.44
352 353 5.163814 CCTTACGCTCTTCTTTCTGAAATGG 60.164 44.000 2.88 0.00 33.79 3.16
449 450 7.499563 TGGAGTGACTTACTATAGCAGTCTTAG 59.500 40.741 23.61 3.90 40.53 2.18
450 451 7.344134 TGGAGTGACTTACTATAGCAGTCTTA 58.656 38.462 23.61 9.85 40.53 2.10
505 506 5.011329 AGCATCAAACATCATCAAAGTTGGT 59.989 36.000 0.00 0.00 0.00 3.67
518 539 5.543714 TCAAAGCATCAAAGCATCAAACAT 58.456 33.333 0.00 0.00 36.85 2.71
808 841 9.862371 GAAGAAGATGATGACTAGTAACTTGAA 57.138 33.333 0.00 0.00 0.00 2.69
1028 1096 3.904339 AGACTTTGGCTCTTCACCTTCTA 59.096 43.478 0.00 0.00 0.00 2.10
1536 1680 1.679139 TCAACAACAAGTGCTCCCAG 58.321 50.000 0.00 0.00 0.00 4.45
1696 1840 8.593945 AACTCAATTTAGAGCCCAATTAATCA 57.406 30.769 0.00 0.00 39.26 2.57
1853 2003 3.190744 GGCCACAACCTTTTTAGTCTAGC 59.809 47.826 0.00 0.00 0.00 3.42
1907 2062 1.474077 CTGGGAATGGAGCCTTTTTCG 59.526 52.381 0.00 0.00 0.00 3.46
1952 2108 2.520982 CATCTGCATGGGCCTGGG 60.521 66.667 4.53 0.00 40.13 4.45
1990 2152 6.101588 AGCCCAATAATTCAGCCCATTTAATT 59.898 34.615 0.00 0.00 0.00 1.40
1991 2153 5.608015 AGCCCAATAATTCAGCCCATTTAAT 59.392 36.000 0.00 0.00 0.00 1.40
1992 2154 4.968080 AGCCCAATAATTCAGCCCATTTAA 59.032 37.500 0.00 0.00 0.00 1.52
2020 2182 1.651987 CATTTCGGCCGTCTACATGT 58.348 50.000 27.15 2.69 0.00 3.21
2081 2243 1.469251 GCAAGCTGATGTGGCAGAATG 60.469 52.381 0.00 0.00 38.14 2.67
2210 2376 6.128580 GGCCTCGTAAACTAAAATTAACGACA 60.129 38.462 0.00 0.00 0.00 4.35


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.