AutoCloner

Multiple sequence alignment - TraesCS6D01G209400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)

BLAST Results

Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

	qseqid	sseqid	percentage.identical	alignment.length	no.mismatch	no.gap.openings	qstart	qend	sstart	send	evalue	bitscore
0	TraesCS6D01G209400	chr6D	100.000	3199	0	0	1	3199	296196305	296193107	0.000000e+00	5908.0
1	TraesCS6D01G209400	chr6B	92.342	1815	92	21	734	2525	461333137	461334927	0.000000e+00	2538.0
2	TraesCS6D01G209400	chr6B	89.195	472	23	9	1	445	461269682	461270152	5.990000e-157	564.0
3	TraesCS6D01G209400	chr6B	89.753	283	18	7	2917	3190	461341738	461342018	5.080000e-93	351.0
4	TraesCS6D01G209400	chr6B	81.911	293	14	12	2708	2987	461341338	461341604	8.990000e-51	211.0
5	TraesCS6D01G209400	chr6B	92.661	109	8	0	1099	1207	182642689	182642581	1.190000e-34	158.0
6	TraesCS6D01G209400	chr6B	89.362	94	2	4	2627	2713	461335837	461335929	9.380000e-21	111.0
7	TraesCS6D01G209400	chr6B	94.286	70	2	1	2577	2646	461334946	461335013	4.360000e-19	106.0
8	TraesCS6D01G209400	chr6A	89.736	1968	137	27	762	2685	421754997	421753051	0.000000e+00	2455.0
9	TraesCS6D01G209400	chr6A	88.960	471	24	10	2	445	421767861	421767392	1.000000e-154	556.0
10	TraesCS6D01G209400	chr2D	90.710	183	9	3	448	622	73966788	73966606	1.480000e-58	237.0
11	TraesCS6D01G209400	chr2D	91.111	180	8	3	448	619	651313815	651313636	1.480000e-58	237.0
12	TraesCS6D01G209400	chr2D	78.947	342	55	13	1724	2062	484329058	484329385	1.930000e-52	217.0
13	TraesCS6D01G209400	chr2D	92.920	113	8	0	1095	1207	484326990	484327102	7.100000e-37	165.0
14	TraesCS6D01G209400	chr2D	79.856	139	19	6	2979	3109	174392784	174392921	3.400000e-15	93.5
15	TraesCS6D01G209400	chr2A	80.059	341	50	14	1724	2062	628584207	628584531	1.480000e-58	237.0
16	TraesCS6D01G209400	chr2A	94.690	113	6	0	1095	1207	628582630	628582742	3.280000e-40	176.0
17	TraesCS6D01G209400	chr2A	91.892	111	9	0	1097	1207	115430467	115430577	4.270000e-34	156.0
18	TraesCS6D01G209400	chr7D	89.175	194	11	5	439	623	48555438	48555246	1.920000e-57	233.0
19	TraesCS6D01G209400	chr7D	89.617	183	11	3	448	622	229802649	229802467	3.210000e-55	226.0
20	TraesCS6D01G209400	chr7D	90.000	180	10	3	448	619	553212741	553212920	3.210000e-55	226.0
21	TraesCS6D01G209400	chr5D	90.556	180	9	3	448	619	526241575	526241396	6.900000e-57	231.0
22	TraesCS6D01G209400	chr1D	90.556	180	9	3	448	619	490396904	490397083	6.900000e-57	231.0
23	TraesCS6D01G209400	chr1D	89.617	183	11	3	448	622	56635579	56635397	3.210000e-55	226.0
24	TraesCS6D01G209400	chr4A	90.854	164	9	5	457	618	669391367	669391208	6.950000e-52	215.0
25	TraesCS6D01G209400	chr2B	96.460	113	4	0	1095	1207	569017251	569017363	1.520000e-43	187.0
26	TraesCS6D01G209400	chr2B	91.176	136	12	0	1724	1859	569018726	569018861	5.450000e-43	185.0
27	TraesCS6D01G209400	chr2B	94.318	88	4	1	1726	1813	519692106	519692020	2.000000e-27	134.0
28	TraesCS6D01G209400	chr2B	100.000	37	0	0	2162	2198	519691971	519691935	5.730000e-08	69.4
29	TraesCS6D01G209400	chr1B	92.793	111	8	0	1097	1207	93950387	93950497	9.180000e-36	161.0
30	TraesCS6D01G209400	chr7A	90.756	119	9	1	1091	1207	611767817	611767935	1.190000e-34	158.0

These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

	query	scaffold	start	end	length	rev.comp	avg.bitscore	max.bitscore	avg.percent.identical	query.start	query.end	num_hsp	groupid	homo_length
0	TraesCS6D01G209400	chr6D	296193107	296196305	3198	True	5908.000000	5908	100.000000	1	3199	1	chr6D.!!$R1	3198
1	TraesCS6D01G209400	chr6B	461333137	461335929	2792	False	918.333333	2538	91.996667	734	2713	3	chr6B.!!$F2	1979
2	TraesCS6D01G209400	chr6B	461341338	461342018	680	False	281.000000	351	85.832000	2708	3190	2	chr6B.!!$F3	482
3	TraesCS6D01G209400	chr6A	421753051	421754997	1946	True	2455.000000	2455	89.736000	762	2685	1	chr6A.!!$R1	1923
4	TraesCS6D01G209400	chr2A	628582630	628584531	1901	False	206.500000	237	87.374500	1095	2062	2	chr2A.!!$F2	967

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)

Position	MSA Position	Penalty	Sequence	TM	GC	Self any TH	Self end TH	Hairpin	End Stability	Orientation
120	121	0.032813	CCATGGATGGGAGCAAACCT	60.033	55.0	5.56	0.0	44.31	3.50	F
264	265	0.036010	AGAAAGATGCCCACTCACCG	60.036	55.0	0.00	0.0	0.00	4.94	F
410	411	0.105778	GGGAGGAAGAAGATGCCGAG	59.894	60.0	0.00	0.0	0.00	4.63	F
645	646	0.247736	ACTGCGGAATCTCTGTGACC	59.752	55.0	0.00	0.0	0.00	4.02	F

Position	MSA Position	Penalty	Sequence	TM	GC	Self any TH	Self end TH	Hairpin	End Stability	Orientation
1214	1224	0.181587	TCGGAACTCCAACCAGCAAA	59.818	50.000	0.0	0.0	35.14	3.68	R
1878	2949	2.064434	TCCAAATGTTGCAGGTGTCA	57.936	45.000	0.0	0.0	0.00	3.58	R
1928	2999	2.746904	TCACATCTACAAAATGGCACCG	59.253	45.455	0.0	0.0	0.00	4.94	R
2534	3615	1.234821	TTGACCAACAATGAGCCGAC	58.765	50.000	0.0	0.0	33.18	4.79	R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)

Show entries

Search:

Position	MSA Position	Penalty	Sequence	TM	GC	Self any TH	Self end TH	Hairpin	End Stability
22	23	4.454948	CCGCTGATCCGGCAATAA	57.545	55.556	0.00	0.00	42.03	1.40
23	24	2.932663	CCGCTGATCCGGCAATAAT	58.067	52.632	0.00	0.00	42.03	1.28
24	25	0.798776	CCGCTGATCCGGCAATAATC	59.201	55.000	0.00	0.00	42.03	1.75
25	26	1.609061	CCGCTGATCCGGCAATAATCT	60.609	52.381	0.00	0.00	42.03	2.40
26	27	2.146342	CGCTGATCCGGCAATAATCTT	58.854	47.619	0.00	0.00	35.10	2.40
27	28	3.325870	CGCTGATCCGGCAATAATCTTA	58.674	45.455	0.00	0.00	35.10	2.10
28	29	3.123621	CGCTGATCCGGCAATAATCTTAC	59.876	47.826	0.00	0.00	35.10	2.34
29	30	4.065088	GCTGATCCGGCAATAATCTTACA	58.935	43.478	0.00	0.00	35.55	2.41
30	31	4.515191	GCTGATCCGGCAATAATCTTACAA	59.485	41.667	0.00	0.00	35.55	2.41
31	32	5.560953	GCTGATCCGGCAATAATCTTACAAC	60.561	44.000	0.00	0.00	35.55	3.32
32	33	4.819630	TGATCCGGCAATAATCTTACAACC	59.180	41.667	0.00	0.00	0.00	3.77
33	34	4.223556	TCCGGCAATAATCTTACAACCA	57.776	40.909	0.00	0.00	0.00	3.67
34	35	3.942748	TCCGGCAATAATCTTACAACCAC	59.057	43.478	0.00	0.00	0.00	4.16
35	36	3.945285	CCGGCAATAATCTTACAACCACT	59.055	43.478	0.00	0.00	0.00	4.00
36	37	5.104859	TCCGGCAATAATCTTACAACCACTA	60.105	40.000	0.00	0.00	0.00	2.74
37	38	5.236478	CCGGCAATAATCTTACAACCACTAG	59.764	44.000	0.00	0.00	0.00	2.57
38	39	5.236478	CGGCAATAATCTTACAACCACTAGG	59.764	44.000	0.00	0.00	42.21	3.02
39	40	5.008712	GGCAATAATCTTACAACCACTAGGC	59.991	44.000	0.00	0.00	39.06	3.93
40	41	5.008712	GCAATAATCTTACAACCACTAGGCC	59.991	44.000	0.00	0.00	39.06	5.19
41	42	5.968676	ATAATCTTACAACCACTAGGCCA	57.031	39.130	5.01	0.00	39.06	5.36
42	43	4.650972	AATCTTACAACCACTAGGCCAA	57.349	40.909	5.01	0.00	39.06	4.52
43	44	4.650972	ATCTTACAACCACTAGGCCAAA	57.349	40.909	5.01	0.00	39.06	3.28
44	45	4.015872	TCTTACAACCACTAGGCCAAAG	57.984	45.455	5.01	4.21	39.06	2.77
45	46	2.194201	TACAACCACTAGGCCAAAGC	57.806	50.000	5.01	0.00	39.06	3.51
46	47	0.184933	ACAACCACTAGGCCAAAGCA	59.815	50.000	5.01	0.00	42.56	3.91

Showing 1 to 25 of 612 entries

Previous1 2 3 4 5…25Next

Show entries

Search:

Position	MSA Position	Penalty	Sequence	TM	GC	Self any TH	Self end TH	Hairpin	End Stability
0	1	2.892425	GCCGGATCAGCGGTTCTG	60.892	66.667	5.05	0.00	44.21	3.02
1	2	2.257409	ATTGCCGGATCAGCGGTTCT	62.257	55.000	5.05	0.00	0.00	3.01
2	3	0.531974	TATTGCCGGATCAGCGGTTC	60.532	55.000	5.05	0.00	0.00	3.62
3	4	0.107410	TTATTGCCGGATCAGCGGTT	60.107	50.000	5.05	1.51	0.00	4.44
5	6	0.798776	GATTATTGCCGGATCAGCGG	59.201	55.000	5.05	6.08	0.00	5.52
6	7	1.800805	AGATTATTGCCGGATCAGCG	58.199	50.000	5.05	0.00	0.00	5.18
7	8	4.065088	TGTAAGATTATTGCCGGATCAGC	58.935	43.478	5.05	0.00	0.00	4.26
8	9	5.049405	GGTTGTAAGATTATTGCCGGATCAG	60.049	44.000	5.05	0.00	0.00	2.90
9	10	4.819630	GGTTGTAAGATTATTGCCGGATCA	59.180	41.667	5.05	0.00	0.00	2.92
12	13	3.942748	GTGGTTGTAAGATTATTGCCGGA	59.057	43.478	5.05	0.00	0.00	5.14
13	14	3.945285	AGTGGTTGTAAGATTATTGCCGG	59.055	43.478	0.00	0.00	0.00	6.13
14	15	5.236478	CCTAGTGGTTGTAAGATTATTGCCG	59.764	44.000	0.00	0.00	0.00	5.69
15	16	5.008712	GCCTAGTGGTTGTAAGATTATTGCC	59.991	44.000	0.00	0.00	35.27	4.52
17	18	6.119536	TGGCCTAGTGGTTGTAAGATTATTG	58.880	40.000	3.32	0.00	35.27	1.90
18	19	6.321821	TGGCCTAGTGGTTGTAAGATTATT	57.678	37.500	3.32	0.00	35.27	1.40
20	21	5.765576	TTGGCCTAGTGGTTGTAAGATTA	57.234	39.130	3.32	0.00	35.27	1.75
21	22	4.650972	TTGGCCTAGTGGTTGTAAGATT	57.349	40.909	3.32	0.00	35.27	2.40
22	23	4.589908	CTTTGGCCTAGTGGTTGTAAGAT	58.410	43.478	3.32	0.00	35.27	2.40
23	24	3.809324	GCTTTGGCCTAGTGGTTGTAAGA	60.809	47.826	3.32	0.00	35.27	2.10
24	25	2.488153	GCTTTGGCCTAGTGGTTGTAAG	59.512	50.000	3.32	0.00	35.27	2.34
25	26	2.158593	TGCTTTGGCCTAGTGGTTGTAA	60.159	45.455	3.32	0.00	37.74	2.41
26	27	1.422024	TGCTTTGGCCTAGTGGTTGTA	59.578	47.619	3.32	0.00	37.74	2.41
27	28	0.184933	TGCTTTGGCCTAGTGGTTGT	59.815	50.000	3.32	0.00	37.74	3.32
28	29	0.598065	GTGCTTTGGCCTAGTGGTTG	59.402	55.000	3.32	0.00	37.74	3.77
29	30	0.539669	GGTGCTTTGGCCTAGTGGTT	60.540	55.000	3.32	0.00	37.74	3.67

Showing 1 to 25 of 648 entries

Previous1 2 3 4 5…26Next

Based at the University of Bristol with support from BBSRC.

AutoCloner maintained by Alex Coulton.