Multiple sequence alignment - TraesCS6D01G200800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6D01G200800 chr6D 100.000 2342 0 0 1 2342 283187618 283189959 0 4325
1 TraesCS6D01G200800 chrUn 98.294 2345 37 3 1 2342 257944316 257946660 0 4106
2 TraesCS6D01G200800 chrUn 98.124 2345 36 6 1 2342 233525064 233522725 0 4080
3 TraesCS6D01G200800 chr1D 98.081 2345 42 3 1 2342 212429073 212431417 0 4078
4 TraesCS6D01G200800 chr2D 97.995 2344 44 3 1 2342 637308501 637306159 0 4065
5 TraesCS6D01G200800 chr4D 97.868 2345 47 3 1 2342 123689166 123691510 0 4050
6 TraesCS6D01G200800 chr7B 97.825 2345 42 7 1 2342 698126729 698124391 0 4039
7 TraesCS6D01G200800 chr7B 97.441 2345 52 6 1 2342 716795634 716793295 0 3991
8 TraesCS6D01G200800 chr7A 97.783 2345 44 6 1 2342 60095994 60093655 0 4036
9 TraesCS6D01G200800 chr7A 97.399 2345 58 3 1 2342 211237930 211235586 0 3989


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6D01G200800 chr6D 283187618 283189959 2341 False 4325 4325 100.000 1 2342 1 chr6D.!!$F1 2341
1 TraesCS6D01G200800 chrUn 257944316 257946660 2344 False 4106 4106 98.294 1 2342 1 chrUn.!!$F1 2341
2 TraesCS6D01G200800 chrUn 233522725 233525064 2339 True 4080 4080 98.124 1 2342 1 chrUn.!!$R1 2341
3 TraesCS6D01G200800 chr1D 212429073 212431417 2344 False 4078 4078 98.081 1 2342 1 chr1D.!!$F1 2341
4 TraesCS6D01G200800 chr2D 637306159 637308501 2342 True 4065 4065 97.995 1 2342 1 chr2D.!!$R1 2341
5 TraesCS6D01G200800 chr4D 123689166 123691510 2344 False 4050 4050 97.868 1 2342 1 chr4D.!!$F1 2341
6 TraesCS6D01G200800 chr7B 698124391 698126729 2338 True 4039 4039 97.825 1 2342 1 chr7B.!!$R1 2341
7 TraesCS6D01G200800 chr7B 716793295 716795634 2339 True 3991 3991 97.441 1 2342 1 chr7B.!!$R2 2341
8 TraesCS6D01G200800 chr7A 60093655 60095994 2339 True 4036 4036 97.783 1 2342 1 chr7A.!!$R1 2341
9 TraesCS6D01G200800 chr7A 211235586 211237930 2344 True 3989 3989 97.399 1 2342 1 chr7A.!!$R2 2341

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
138 139 0.532573 GGGAGAACGAGCAGACATCA 59.467 55.000 0.0 0.0 0.0 3.07 F
703 704 1.447838 CCAACGCACGCTAGATGGT 60.448 57.895 0.0 0.0 0.0 3.55 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1313 1315 0.53065 GATCCGAGCGATTGCCTTCA 60.531 55.0 0.00 0.00 44.31 3.02 R
2105 2109 2.26143 TAGTCCCGCTGCGTCCTCTA 62.261 60.0 21.59 13.77 0.00 2.43 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
138 139 0.532573 GGGAGAACGAGCAGACATCA 59.467 55.000 0.00 0.00 0.00 3.07
190 191 5.297776 GTGGAATTCGTCATCAAGATGGATT 59.702 40.000 9.96 6.07 42.90 3.01
273 274 3.660865 TGAAAGAAGGCTACCGAAAGAC 58.339 45.455 0.00 0.00 0.00 3.01
353 354 5.482006 TGGTACTTGTCTGATCAATCACAG 58.518 41.667 0.00 0.00 35.72 3.66
382 383 9.796120 TTCATTAGTTCACTTGATTTTTCGTTT 57.204 25.926 0.00 0.00 0.00 3.60
450 451 2.673523 GCCACTCCATGTCTGGCT 59.326 61.111 15.13 0.00 42.80 4.75
551 552 3.049206 GCTTCACTATCGCTCATGACTC 58.951 50.000 0.00 0.00 0.00 3.36
554 555 2.683362 TCACTATCGCTCATGACTCGTT 59.317 45.455 11.09 6.87 0.00 3.85
561 562 2.987149 CGCTCATGACTCGTTGTAGTTT 59.013 45.455 0.00 0.00 0.00 2.66
637 638 5.441718 TCCTGAATGCCTCTTTCTTGTAT 57.558 39.130 0.00 0.00 0.00 2.29
703 704 1.447838 CCAACGCACGCTAGATGGT 60.448 57.895 0.00 0.00 0.00 3.55
763 764 3.075005 TAGCTTCCGCGCCCTTCT 61.075 61.111 0.00 0.00 42.32 2.85
1022 1024 3.942829 TGCTGTTTTCTATCAGTCCCAG 58.057 45.455 0.00 0.00 34.57 4.45
1037 1039 1.843376 CCAGGCGGATACTCCCCAT 60.843 63.158 0.00 0.00 44.96 4.00
1313 1315 0.949105 GTGAGCACGTTTGGATCCGT 60.949 55.000 7.39 0.00 37.90 4.69
1744 1748 2.138320 CATGTATGGGTGACAGATCGC 58.862 52.381 0.00 0.00 34.35 4.58
2009 2013 1.299976 GAAAGGGGGCGACTGATGT 59.700 57.895 0.00 0.00 0.00 3.06
2105 2109 1.469308 GATGAGACGAGACGGACTGTT 59.531 52.381 0.00 0.00 0.00 3.16
2126 2130 3.450115 GGACGCAGCGGGACTACT 61.450 66.667 21.15 0.00 0.00 2.57
2200 2204 7.253618 GCGCATATTCGAGATTTAGAATCTCTC 60.254 40.741 21.66 6.32 41.68 3.20
2337 2341 2.799371 GGACCGTAGCTCCTCACG 59.201 66.667 0.00 0.00 37.89 4.35
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
20 21 5.188434 TCATTCATCTTGATGTTCCCACTC 58.812 41.667 10.01 0.00 0.00 3.51
160 161 6.280643 TCTTGATGACGAATTCCACGATAAT 58.719 36.000 0.00 0.00 34.70 1.28
236 237 7.090173 CCTTCTTTCATTTCCGAATTTGCTTA 58.910 34.615 0.00 0.00 0.00 3.09
353 354 8.682016 CGAAAAATCAAGTGAACTAATGAACAC 58.318 33.333 0.00 0.00 0.00 3.32
382 383 3.678056 AGTAAGCGGTTCAAGACATCA 57.322 42.857 1.59 0.00 0.00 3.07
450 451 0.889638 AGTGAGCGAGACCAAGACGA 60.890 55.000 0.00 0.00 0.00 4.20
551 552 9.488124 GACTACTACATAGAGAAAACTACAACG 57.512 37.037 0.00 0.00 34.65 4.10
554 555 7.201679 GCCGACTACTACATAGAGAAAACTACA 60.202 40.741 0.00 0.00 34.65 2.74
561 562 4.434545 AGGCCGACTACTACATAGAGAA 57.565 45.455 0.00 0.00 34.65 2.87
763 764 2.892215 TCACATCAATTGAAGCAGGCAA 59.108 40.909 13.09 0.00 0.00 4.52
1037 1039 0.539986 GGTAAGCGGACCATGGAAGA 59.460 55.000 21.47 0.00 39.51 2.87
1121 1123 2.415962 ATCCTCTGTCACCCCCACCA 62.416 60.000 0.00 0.00 0.00 4.17
1313 1315 0.530650 GATCCGAGCGATTGCCTTCA 60.531 55.000 0.00 0.00 44.31 3.02
1971 1975 7.339466 CCCTTTCCTATTTAGCTTTTCTTGCTA 59.661 37.037 0.00 0.00 41.46 3.49
1978 1982 4.030913 GCCCCCTTTCCTATTTAGCTTTT 58.969 43.478 0.00 0.00 0.00 2.27
2105 2109 2.261430 TAGTCCCGCTGCGTCCTCTA 62.261 60.000 21.59 13.77 0.00 2.43


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.