Multiple sequence alignment - TraesCS6D01G200600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6D01G200600 chr6D 100.000 2297 0 0 1 2297 283155487 283157783 0.000000e+00 4242
1 TraesCS6D01G200600 chr2D 97.710 2314 36 4 1 2297 644701526 644703839 0.000000e+00 3964
2 TraesCS6D01G200600 chr2D 97.633 1859 31 2 452 2297 635068900 635067042 0.000000e+00 3177
3 TraesCS6D01G200600 chrUn 97.707 2311 38 4 1 2297 45099058 45101367 0.000000e+00 3960
4 TraesCS6D01G200600 chrUn 97.664 2312 39 4 1 2297 261514800 261512489 0.000000e+00 3956
5 TraesCS6D01G200600 chrUn 97.232 2312 44 5 1 2297 186162048 186164354 0.000000e+00 3897
6 TraesCS6D01G200600 chrUn 96.786 1058 21 2 1253 2297 365031619 365030562 0.000000e+00 1753
7 TraesCS6D01G200600 chrUn 95.215 418 8 1 1892 2297 404775367 404774950 0.000000e+00 651
8 TraesCS6D01G200600 chr5B 97.707 2311 38 4 1 2297 130613167 130615476 0.000000e+00 3960
9 TraesCS6D01G200600 chr5B 97.447 2311 44 4 1 2297 130608143 130610452 0.000000e+00 3927
10 TraesCS6D01G200600 chr5B 97.277 2314 46 4 1 2297 130570493 130568180 0.000000e+00 3908
11 TraesCS6D01G200600 chr3A 97.534 2311 43 4 1 2297 66032048 66029738 0.000000e+00 3940
12 TraesCS6D01G200600 chr7B 97.274 2311 49 3 1 2297 743035435 743033125 0.000000e+00 3906
13 TraesCS6D01G200600 chr3D 96.847 2315 54 5 1 2297 154714689 154717002 0.000000e+00 3853
14 TraesCS6D01G200600 chr7D 97.955 1907 26 2 404 2297 626648934 626650840 0.000000e+00 3293
15 TraesCS6D01G200600 chr6B 94.976 418 9 1 1892 2297 596592987 596592570 0.000000e+00 645
16 TraesCS6D01G200600 chr6B 94.976 418 9 1 1892 2297 681549760 681549343 0.000000e+00 645
17 TraesCS6D01G200600 chr1B 94.737 418 10 1 1892 2297 461425286 461424869 6.920000e-180 640


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6D01G200600 chr6D 283155487 283157783 2296 False 4242.0 4242 100.000 1 2297 1 chr6D.!!$F1 2296
1 TraesCS6D01G200600 chr2D 644701526 644703839 2313 False 3964.0 3964 97.710 1 2297 1 chr2D.!!$F1 2296
2 TraesCS6D01G200600 chr2D 635067042 635068900 1858 True 3177.0 3177 97.633 452 2297 1 chr2D.!!$R1 1845
3 TraesCS6D01G200600 chrUn 45099058 45101367 2309 False 3960.0 3960 97.707 1 2297 1 chrUn.!!$F1 2296
4 TraesCS6D01G200600 chrUn 261512489 261514800 2311 True 3956.0 3956 97.664 1 2297 1 chrUn.!!$R1 2296
5 TraesCS6D01G200600 chrUn 186162048 186164354 2306 False 3897.0 3897 97.232 1 2297 1 chrUn.!!$F2 2296
6 TraesCS6D01G200600 chrUn 365030562 365031619 1057 True 1753.0 1753 96.786 1253 2297 1 chrUn.!!$R2 1044
7 TraesCS6D01G200600 chr5B 130608143 130615476 7333 False 3943.5 3960 97.577 1 2297 2 chr5B.!!$F1 2296
8 TraesCS6D01G200600 chr5B 130568180 130570493 2313 True 3908.0 3908 97.277 1 2297 1 chr5B.!!$R1 2296
9 TraesCS6D01G200600 chr3A 66029738 66032048 2310 True 3940.0 3940 97.534 1 2297 1 chr3A.!!$R1 2296
10 TraesCS6D01G200600 chr7B 743033125 743035435 2310 True 3906.0 3906 97.274 1 2297 1 chr7B.!!$R1 2296
11 TraesCS6D01G200600 chr3D 154714689 154717002 2313 False 3853.0 3853 96.847 1 2297 1 chr3D.!!$F1 2296
12 TraesCS6D01G200600 chr7D 626648934 626650840 1906 False 3293.0 3293 97.955 404 2297 1 chr7D.!!$F1 1893

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
237 5262 0.325933 CAGGAAGGCACATGAGTCCA 59.674 55.0 0.0 0.0 0.0 4.02 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1613 6643 0.266152 ATCCCTCGGACCTGGAGAAT 59.734 55.0 0.0 0.0 32.98 2.4 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
37 38 2.214376 TGTGGGTTGGCTTGGATTAG 57.786 50.000 0.00 0.00 0.00 1.73
93 5118 2.497675 GGATGCGGAGGAGCTATTATCA 59.502 50.000 0.00 0.00 32.33 2.15
237 5262 0.325933 CAGGAAGGCACATGAGTCCA 59.674 55.000 0.00 0.00 0.00 4.02
326 5352 1.375013 GTCCTAGAAACGGCGGCAA 60.375 57.895 13.24 0.00 0.00 4.52
345 5371 4.372656 GCAACTAGCGAGGAGTTAATGAT 58.627 43.478 0.00 0.00 35.36 2.45
370 5396 0.811616 GTGCTGCAACCTAGGGATCG 60.812 60.000 14.81 0.00 0.00 3.69
650 5680 5.505181 AGACAAGATACAACTGTTGGGAT 57.495 39.130 23.15 15.79 34.12 3.85
822 5852 1.598701 GAGCCACATGCAGGGAAACC 61.599 60.000 2.31 0.00 45.69 3.27
1425 6455 1.219724 AGACGGGGTCCTATGGTATGT 59.780 52.381 0.00 0.00 32.18 2.29
1613 6643 2.802724 CCCGACCCAGTGTCACACA 61.803 63.158 11.40 0.00 44.71 3.72
1832 6863 2.477754 GGTAAACGAAAACCACCTCGAG 59.522 50.000 5.13 5.13 38.43 4.04
1857 6888 1.695242 TCTACCGAACAAAGAAGGCCA 59.305 47.619 5.01 0.00 0.00 5.36
2037 7080 7.602517 AGAAATGTGAGAATGTAGTTACAGC 57.397 36.000 0.00 0.00 39.92 4.40
2168 7211 4.619437 GGTTAAACCGAAACACAAGTCA 57.381 40.909 0.00 0.00 0.00 3.41
2178 7221 4.611355 CGAAACACAAGTCAGCGATTCAAT 60.611 41.667 0.00 0.00 0.00 2.57
2189 7232 1.739466 GCGATTCAATCCAAGAGTGCA 59.261 47.619 0.00 0.00 0.00 4.57
2249 7292 0.250295 CTGCTGGAACGAAAGACCCA 60.250 55.000 0.00 0.00 35.56 4.51
2254 7297 3.146066 CTGGAACGAAAGACCCAATGAA 58.854 45.455 0.00 0.00 36.19 2.57
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
5 6 5.005094 GCCAACCCACATTACTAACTAACA 58.995 41.667 0.00 0.00 0.00 2.41
37 38 1.693083 CCTAGGCGCGCAACACTAAC 61.693 60.000 34.42 12.85 0.00 2.34
93 5118 2.127708 CATTAGGTTAGGGAGCTGGGT 58.872 52.381 0.00 0.00 37.30 4.51
214 5239 1.701847 ACTCATGTGCCTTCCTGAACT 59.298 47.619 0.00 0.00 0.00 3.01
237 5262 4.260620 GGTCGCACATTCATAATAGCGTTT 60.261 41.667 14.26 0.00 41.97 3.60
326 5352 3.253677 CCGATCATTAACTCCTCGCTAGT 59.746 47.826 0.00 0.00 0.00 2.57
342 5368 2.027073 GTTGCAGCACGTCCGATCA 61.027 57.895 0.00 0.00 0.00 2.92
345 5371 2.486636 CTAGGTTGCAGCACGTCCGA 62.487 60.000 2.05 0.00 0.00 4.55
370 5396 3.808656 GCGAAAGAGCTGCCTGGC 61.809 66.667 12.87 12.87 0.00 4.85
650 5680 2.711009 GGTCCTATTGATCATGTCCCCA 59.289 50.000 0.00 0.00 0.00 4.96
668 5698 3.866582 CCCGGATCCAGCCAGGTC 61.867 72.222 13.41 0.00 39.02 3.85
822 5852 2.896801 GCCAGAACCACACGTGCAG 61.897 63.158 17.22 9.86 0.00 4.41
897 5927 6.490040 TCCAGAATAAATGGGCAATAGTTAGC 59.510 38.462 0.00 0.00 38.44 3.09
1248 6278 2.482796 TAGTAGTCCGGTCGCACCCA 62.483 60.000 0.00 0.00 33.75 4.51
1285 6315 8.862085 AGGGTCTCTACAAGTCTATAAATAAGC 58.138 37.037 0.00 0.00 0.00 3.09
1507 6537 1.200519 CCTTCGGAATACCCCAGACA 58.799 55.000 0.00 0.00 0.00 3.41
1613 6643 0.266152 ATCCCTCGGACCTGGAGAAT 59.734 55.000 0.00 0.00 32.98 2.40
1847 6878 2.434774 GACGGGGTGGCCTTCTTT 59.565 61.111 3.32 0.00 0.00 2.52
1857 6888 3.069289 GTGTTAATTCTTTCGACGGGGT 58.931 45.455 0.00 0.00 0.00 4.95
2168 7211 2.012673 GCACTCTTGGATTGAATCGCT 58.987 47.619 0.00 0.00 0.00 4.93
2178 7221 1.708993 AAGGTGCCTGCACTCTTGGA 61.709 55.000 20.52 0.00 45.52 3.53
2189 7232 1.192146 TGACCGCTCTTAAGGTGCCT 61.192 55.000 1.85 0.00 41.51 4.75
2227 7270 1.149148 GTCTTTCGTTCCAGCAGTCC 58.851 55.000 0.00 0.00 0.00 3.85
2249 7292 6.887545 TGGAAGGTGGTACGAAAATATTCATT 59.112 34.615 0.00 0.00 35.15 2.57
2254 7297 6.659824 AGATTGGAAGGTGGTACGAAAATAT 58.340 36.000 0.00 0.00 0.00 1.28


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.