Multiple sequence alignment - TraesCS6D01G196500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6D01G196500 chr6D 100.000 4791 0 0 1 4791 272804837 272809627 0.000000e+00 8848.0
1 TraesCS6D01G196500 chr6D 99.630 4055 13 2 1 4054 272847159 272851212 0.000000e+00 7404.0
2 TraesCS6D01G196500 chr6D 100.000 1671 0 0 1430 3100 272823655 272825325 0.000000e+00 3086.0
3 TraesCS6D01G196500 chr6D 100.000 1016 0 0 1 1016 272822551 272823566 0.000000e+00 1877.0
4 TraesCS6D01G196500 chr6D 99.595 740 2 1 4053 4791 272851252 272851991 0.000000e+00 1349.0
5 TraesCS6D01G196500 chr6D 100.000 517 0 0 4275 4791 272826896 272827412 0.000000e+00 955.0
6 TraesCS6D01G196500 chrUn 99.696 2628 7 1 1430 4057 329441338 329438712 0.000000e+00 4807.0
7 TraesCS6D01G196500 chrUn 100.000 2083 0 0 1018 3100 355089881 355087799 0.000000e+00 3847.0
8 TraesCS6D01G196500 chrUn 99.379 161 0 1 4053 4212 329438675 329438515 1.690000e-74 291.0
9 TraesCS6D01G196500 chr6B 96.365 2008 56 7 2063 4054 434185599 434187605 0.000000e+00 3288.0
10 TraesCS6D01G196500 chr6B 92.513 2097 75 27 1 2059 434183512 434185564 0.000000e+00 2928.0
11 TraesCS6D01G196500 chr6B 86.301 146 12 3 4128 4265 434188376 434188521 8.300000e-33 152.0
12 TraesCS6D01G196500 chr6B 93.478 46 2 1 4351 4395 679281830 679281785 3.090000e-07 67.6
13 TraesCS6D01G196500 chr6B 95.349 43 1 1 4351 4392 704427125 704427167 3.090000e-07 67.6
14 TraesCS6D01G196500 chr6A 96.376 1849 59 4 2063 3905 389759410 389761256 0.000000e+00 3037.0
15 TraesCS6D01G196500 chr6A 91.771 1762 74 24 266 1987 389757545 389759275 0.000000e+00 2385.0
16 TraesCS6D01G196500 chr6A 91.727 278 12 6 2 268 389755403 389755680 4.530000e-100 375.0
17 TraesCS6D01G196500 chr6A 94.012 167 8 2 3889 4054 389761933 389762098 7.960000e-63 252.0
18 TraesCS6D01G196500 chr6A 94.118 85 5 0 1976 2060 389759292 389759376 3.890000e-26 130.0
19 TraesCS6D01G196500 chr3D 82.051 117 18 3 4676 4791 560194266 560194152 3.950000e-16 97.1
20 TraesCS6D01G196500 chr2D 82.051 117 18 3 4676 4791 99686761 99686875 3.950000e-16 97.1
21 TraesCS6D01G196500 chr4B 84.416 77 8 2 4163 4237 630003893 630003819 6.650000e-09 73.1
22 TraesCS6D01G196500 chr4B 100.000 29 0 0 4390 4418 18440856 18440828 2.000000e-03 54.7
23 TraesCS6D01G196500 chr3B 97.500 40 1 0 4349 4388 820351000 820350961 8.600000e-08 69.4
24 TraesCS6D01G196500 chr7D 95.349 43 1 1 4351 4392 15083851 15083893 3.090000e-07 67.6
25 TraesCS6D01G196500 chr7D 85.294 68 6 3 4351 4414 59471372 59471305 3.090000e-07 67.6
26 TraesCS6D01G196500 chr5B 91.837 49 2 2 4342 4389 670532708 670532755 3.090000e-07 67.6
27 TraesCS6D01G196500 chr2B 95.349 43 1 1 4351 4392 55859712 55859754 3.090000e-07 67.6


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6D01G196500 chr6D 272804837 272809627 4790 False 8848.000000 8848 100.000000 1 4791 1 chr6D.!!$F1 4790
1 TraesCS6D01G196500 chr6D 272847159 272851991 4832 False 4376.500000 7404 99.612500 1 4791 2 chr6D.!!$F3 4790
2 TraesCS6D01G196500 chr6D 272822551 272827412 4861 False 1972.666667 3086 100.000000 1 4791 3 chr6D.!!$F2 4790
3 TraesCS6D01G196500 chrUn 355087799 355089881 2082 True 3847.000000 3847 100.000000 1018 3100 1 chrUn.!!$R1 2082
4 TraesCS6D01G196500 chrUn 329438515 329441338 2823 True 2549.000000 4807 99.537500 1430 4212 2 chrUn.!!$R2 2782
5 TraesCS6D01G196500 chr6B 434183512 434188521 5009 False 2122.666667 3288 91.726333 1 4265 3 chr6B.!!$F2 4264
6 TraesCS6D01G196500 chr6A 389755403 389762098 6695 False 1235.800000 3037 93.600800 2 4054 5 chr6A.!!$F1 4052

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
3451 5459 3.253838 CCAAAGACCCGGTCCCCA 61.254 66.667 14.32 0.0 32.18 4.96 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
4273 7695 6.599244 CCACCAATGCAATCTCTCTAAAAGTA 59.401 38.462 0.0 0.0 0.0 2.24 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
3451 5459 3.253838 CCAAAGACCCGGTCCCCA 61.254 66.667 14.32 0.00 32.18 4.96
3595 5603 2.430244 CTGGACAACGACGACGGG 60.430 66.667 12.58 5.98 44.46 5.28
3855 5877 2.046217 GTTGAACTCCCCCGGCTC 60.046 66.667 0.00 0.00 0.00 4.70
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
3451 5459 3.842923 CTCGGGAGCATGCTCGGT 61.843 66.667 34.96 9.38 43.59 4.69
3459 5467 3.317436 ATGGAGGACCTCGGGAGCA 62.317 63.158 15.46 7.58 37.04 4.26
3855 5877 2.388310 AACCAAACCAAACCAAACCG 57.612 45.000 0.00 0.00 0.00 4.44
4273 7695 6.599244 CCACCAATGCAATCTCTCTAAAAGTA 59.401 38.462 0.00 0.00 0.00 2.24


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.