Multiple sequence alignment - TraesCS6D01G181500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6D01G181500 chr6D 100.000 2453 0 0 1 2453 206557663 206555211 0 4530
1 TraesCS6D01G181500 chr6A 97.780 1937 33 2 1 1937 435769435 435767509 0 3330
2 TraesCS6D01G181500 chr6A 98.497 865 8 3 1077 1938 4738450 4739312 0 1520
3 TraesCS6D01G181500 chr6A 97.808 593 9 2 1348 1937 290257729 290258320 0 1020
4 TraesCS6D01G181500 chr6A 97.104 518 12 3 1938 2453 276304833 276305349 0 870
5 TraesCS6D01G181500 chr7A 97.730 1938 34 2 1 1938 15531293 15533220 0 3326
6 TraesCS6D01G181500 chr3A 97.575 1938 44 3 1 1938 600335841 600337775 0 3315
7 TraesCS6D01G181500 chr3A 98.614 1082 13 1 856 1937 313528510 313527431 0 1914
8 TraesCS6D01G181500 chr3A 97.504 641 16 0 1 641 313529731 313529091 0 1096
9 TraesCS6D01G181500 chr4A 98.566 1813 21 3 128 1937 314681471 314683281 0 3199
10 TraesCS6D01G181500 chr1B 93.927 1943 74 18 1 1937 669245961 669247865 0 2894
11 TraesCS6D01G181500 chr1B 94.218 1401 53 14 512 1908 669253926 669255302 0 2113
12 TraesCS6D01G181500 chr7B 92.237 1958 99 24 1 1938 78311103 78313027 0 2724
13 TraesCS6D01G181500 chr7B 95.150 1567 54 9 1 1565 109934076 109935622 0 2453
14 TraesCS6D01G181500 chr4B 92.300 1883 92 18 1 1861 653648474 653646623 0 2625
15 TraesCS6D01G181500 chr6B 98.256 516 6 3 1938 2453 320412434 320411922 0 900


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6D01G181500 chr6D 206555211 206557663 2452 True 4530 4530 100.000 1 2453 1 chr6D.!!$R1 2452
1 TraesCS6D01G181500 chr6A 435767509 435769435 1926 True 3330 3330 97.780 1 1937 1 chr6A.!!$R1 1936
2 TraesCS6D01G181500 chr6A 4738450 4739312 862 False 1520 1520 98.497 1077 1938 1 chr6A.!!$F1 861
3 TraesCS6D01G181500 chr6A 290257729 290258320 591 False 1020 1020 97.808 1348 1937 1 chr6A.!!$F3 589
4 TraesCS6D01G181500 chr6A 276304833 276305349 516 False 870 870 97.104 1938 2453 1 chr6A.!!$F2 515
5 TraesCS6D01G181500 chr7A 15531293 15533220 1927 False 3326 3326 97.730 1 1938 1 chr7A.!!$F1 1937
6 TraesCS6D01G181500 chr3A 600335841 600337775 1934 False 3315 3315 97.575 1 1938 1 chr3A.!!$F1 1937
7 TraesCS6D01G181500 chr3A 313527431 313529731 2300 True 1505 1914 98.059 1 1937 2 chr3A.!!$R1 1936
8 TraesCS6D01G181500 chr4A 314681471 314683281 1810 False 3199 3199 98.566 128 1937 1 chr4A.!!$F1 1809
9 TraesCS6D01G181500 chr1B 669245961 669247865 1904 False 2894 2894 93.927 1 1937 1 chr1B.!!$F1 1936
10 TraesCS6D01G181500 chr1B 669253926 669255302 1376 False 2113 2113 94.218 512 1908 1 chr1B.!!$F2 1396
11 TraesCS6D01G181500 chr7B 78311103 78313027 1924 False 2724 2724 92.237 1 1938 1 chr7B.!!$F1 1937
12 TraesCS6D01G181500 chr7B 109934076 109935622 1546 False 2453 2453 95.150 1 1565 1 chr7B.!!$F2 1564
13 TraesCS6D01G181500 chr4B 653646623 653648474 1851 True 2625 2625 92.300 1 1861 1 chr4B.!!$R1 1860
14 TraesCS6D01G181500 chr6B 320411922 320412434 512 True 900 900 98.256 1938 2453 1 chr6B.!!$R1 515

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
752 759 5.615289 ACTGTTAGTCTTTGTGCTTCATCT 58.385 37.5 0.0 0.0 0.0 2.9 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2210 2634 9.63552 GAGCTGTAGTGTTAGTTTAATTGTAGA 57.364 33.333 0.0 0.0 0.0 2.59 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
220 221 7.119699 CAGAAATGACAGCACTAATGAGGTTTA 59.880 37.037 0.0 0.0 0.00 2.01
644 649 6.313744 ACAAAGTACAAACTCCTAATGCAC 57.686 37.500 0.0 0.0 33.75 4.57
752 759 5.615289 ACTGTTAGTCTTTGTGCTTCATCT 58.385 37.500 0.0 0.0 0.00 2.90
1509 1901 3.964031 TGTTTGCCTGTTTGGAACCTAAT 59.036 39.130 0.0 0.0 38.35 1.73
2210 2634 1.203570 ACCCACCTCCCTGTAATCCTT 60.204 52.381 0.0 0.0 0.00 3.36
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
220 221 5.885465 ACCTTGATTGATCTTCTCCTTTGT 58.115 37.500 0.00 0.0 0.00 2.83
644 649 9.453325 ACTAAAATGGTAAAATAAACACACACG 57.547 29.630 0.00 0.0 0.00 4.49
752 759 2.552155 CCAATTCCTCTCACAACCGGAA 60.552 50.000 9.46 0.0 39.62 4.30
1415 1806 8.867935 CATCGAACTCATCCATGATAGTATTTC 58.132 37.037 0.00 0.0 36.02 2.17
1509 1901 7.164230 AGGTTCACAAGTTCACAACATAAAA 57.836 32.000 0.00 0.0 0.00 1.52
2210 2634 9.635520 GAGCTGTAGTGTTAGTTTAATTGTAGA 57.364 33.333 0.00 0.0 0.00 2.59


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.