Multiple sequence alignment - TraesCS6D01G176200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6D01G176200 chr6D 100.000 2732 0 0 1 2732 169627968 169630699 0 5046
1 TraesCS6D01G176200 chr1D 97.951 2733 54 2 1 2732 494183976 494186707 0 4735
2 TraesCS6D01G176200 chr1D 97.589 2738 59 2 1 2732 222456655 222453919 0 4684
3 TraesCS6D01G176200 chr1D 97.588 2736 60 2 3 2732 159181239 159183974 0 4682
4 TraesCS6D01G176200 chr4D 97.840 2732 58 1 1 2732 296641351 296644081 0 4717
5 TraesCS6D01G176200 chr3D 97.767 2732 60 1 1 2732 288830081 288827351 0 4706
6 TraesCS6D01G176200 chr3D 97.584 2732 62 2 1 2732 335170119 335167392 0 4676
7 TraesCS6D01G176200 chr7D 97.621 2732 65 0 1 2732 435988568 435991299 0 4686
8 TraesCS6D01G176200 chr2D 97.553 2738 61 4 1 2732 27474962 27477699 0 4680
9 TraesCS6D01G176200 chr5D 97.511 2732 65 1 1 2732 168054151 168056879 0 4665


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6D01G176200 chr6D 169627968 169630699 2731 False 5046 5046 100.000 1 2732 1 chr6D.!!$F1 2731
1 TraesCS6D01G176200 chr1D 494183976 494186707 2731 False 4735 4735 97.951 1 2732 1 chr1D.!!$F2 2731
2 TraesCS6D01G176200 chr1D 222453919 222456655 2736 True 4684 4684 97.589 1 2732 1 chr1D.!!$R1 2731
3 TraesCS6D01G176200 chr1D 159181239 159183974 2735 False 4682 4682 97.588 3 2732 1 chr1D.!!$F1 2729
4 TraesCS6D01G176200 chr4D 296641351 296644081 2730 False 4717 4717 97.840 1 2732 1 chr4D.!!$F1 2731
5 TraesCS6D01G176200 chr3D 288827351 288830081 2730 True 4706 4706 97.767 1 2732 1 chr3D.!!$R1 2731
6 TraesCS6D01G176200 chr3D 335167392 335170119 2727 True 4676 4676 97.584 1 2732 1 chr3D.!!$R2 2731
7 TraesCS6D01G176200 chr7D 435988568 435991299 2731 False 4686 4686 97.621 1 2732 1 chr7D.!!$F1 2731
8 TraesCS6D01G176200 chr2D 27474962 27477699 2737 False 4680 4680 97.553 1 2732 1 chr2D.!!$F1 2731
9 TraesCS6D01G176200 chr5D 168054151 168056879 2728 False 4665 4665 97.511 1 2732 1 chr5D.!!$F1 2731

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
601 603 1.53586 GGCTGCAACGTTTCATGTTGT 60.536 47.619 0.0 0.0 44.66 3.32 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1921 1923 0.911769 TCTCGGAGGCATTTGATGGT 59.088 50.0 4.96 0.0 0.0 3.55 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
47 48 5.221722 TGGGCTCTAGCATAGTTGATTAAGG 60.222 44.000 4.07 0.00 44.36 2.69
267 269 1.602237 CATGGTTAGCCGTGTCCCT 59.398 57.895 9.57 0.00 44.71 4.20
601 603 1.535860 GGCTGCAACGTTTCATGTTGT 60.536 47.619 0.00 0.00 44.66 3.32
790 792 8.094548 TGTAATAAGTGTGTGATTGCTACTCTT 58.905 33.333 0.00 0.00 34.02 2.85
1012 1014 2.363306 TTTAGGAATGGCGGATGCAT 57.637 45.000 0.00 0.00 45.35 3.96
1210 1212 7.225538 CAGTTACTGAACCTATAAGATTGGCTG 59.774 40.741 6.50 0.00 36.08 4.85
1641 1643 4.041567 TGCCCGGATAACTACATCATCATT 59.958 41.667 0.73 0.00 0.00 2.57
1689 1691 5.532032 TGAAGATGACTTTGTTGATGAAGCA 59.468 36.000 0.00 0.00 36.39 3.91
1719 1721 6.924612 CAGATATCATGGAGTCTTCAACTGAG 59.075 42.308 5.32 0.00 38.74 3.35
1722 1724 3.071457 TCATGGAGTCTTCAACTGAGCAA 59.929 43.478 0.00 0.00 38.74 3.91
2048 2059 3.324993 AGGCAACAACAACAACAACAAG 58.675 40.909 0.00 0.00 41.41 3.16
2140 2158 0.248377 GAGCCGATTGTTGCAGATGC 60.248 55.000 0.00 0.00 42.50 3.91
2222 2240 1.005294 GTTTTGCCGCACATCAGCTG 61.005 55.000 7.63 7.63 0.00 4.24
2316 2334 2.472695 TCAGCAAGCTTTCCGTACAT 57.527 45.000 0.00 0.00 0.00 2.29
2329 2347 2.835156 TCCGTACATCCCATGTTTCAGA 59.165 45.455 0.00 0.00 41.63 3.27
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
47 48 2.224161 ACCTCTTCAAGAGCTCACACAC 60.224 50.000 17.77 0.00 40.98 3.82
161 162 1.733912 TCTCGCACTGCATGATGTTTC 59.266 47.619 0.00 0.00 0.00 2.78
267 269 6.620877 AGATACTCAAGTTGTCCATAACCA 57.379 37.500 2.11 0.00 0.00 3.67
356 358 7.872138 TCCAACTCAATCCCAATTAAGTATCT 58.128 34.615 0.00 0.00 0.00 1.98
359 361 6.011981 ACCTCCAACTCAATCCCAATTAAGTA 60.012 38.462 0.00 0.00 0.00 2.24
530 532 7.053498 TGCTGGCAATATAACACATAGAGAAA 58.947 34.615 0.00 0.00 0.00 2.52
601 603 5.106791 CCTTACTCGTCGTCTGAAAAGTCTA 60.107 44.000 0.00 0.00 0.00 2.59
649 651 0.606401 AACTCCAACGGCATCACTGG 60.606 55.000 0.00 0.00 0.00 4.00
790 792 8.682710 GCACAGTACAAATGGAGGATTTATAAA 58.317 33.333 0.00 0.00 32.65 1.40
1012 1014 0.961019 GGTTGCATGAACTTGCTCCA 59.039 50.000 0.00 0.00 43.18 3.86
1210 1212 0.954452 CTCCAGGTTGGTGCTTCAAC 59.046 55.000 12.25 12.25 44.42 3.18
1641 1643 1.512996 GGTCCGAGTCTGTGTCGTCA 61.513 60.000 0.00 0.00 35.59 4.35
1689 1691 4.130719 AGACTCCATGATATCTGCTCCT 57.869 45.455 3.98 0.00 0.00 3.69
1719 1721 6.759497 ATGGTGGTCTACTAGAAATTTTGC 57.241 37.500 0.00 0.00 0.00 3.68
1722 1724 8.993424 ACTGATATGGTGGTCTACTAGAAATTT 58.007 33.333 0.00 0.00 0.00 1.82
1921 1923 0.911769 TCTCGGAGGCATTTGATGGT 59.088 50.000 4.96 0.00 0.00 3.55
2048 2059 3.133365 AACAGGTGGAGGTGGTGGC 62.133 63.158 0.00 0.00 0.00 5.01
2222 2240 2.592861 GATGCTGCGGGTCCATCC 60.593 66.667 0.00 0.00 31.47 3.51
2316 2334 1.988107 AGCTCCTTCTGAAACATGGGA 59.012 47.619 0.00 0.00 0.00 4.37
2421 2439 2.346803 GTCATCTGGTGCATAACGTGT 58.653 47.619 0.00 0.00 0.00 4.49


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.