Multiple sequence alignment - TraesCS6D01G175800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6D01G175800 chr6D 100.000 2440 0 0 1 2440 168756692 168754253 0.000000e+00 4506.0
1 TraesCS6D01G175800 chr6D 98.197 2441 41 2 1 2440 124519124 124516686 0.000000e+00 4261.0
2 TraesCS6D01G175800 chr7D 98.279 2441 41 1 1 2440 381925603 381923163 0.000000e+00 4274.0
3 TraesCS6D01G175800 chr7D 98.076 2443 40 3 1 2440 382051681 382049243 0.000000e+00 4244.0
4 TraesCS6D01G175800 chr7D 97.994 2443 43 4 1 2440 203501601 203499162 0.000000e+00 4235.0
5 TraesCS6D01G175800 chr7D 97.952 2441 40 4 1 2440 381972168 381974599 0.000000e+00 4222.0
6 TraesCS6D01G175800 chr7D 96.468 2180 68 6 1 2176 208636813 208634639 0.000000e+00 3591.0
7 TraesCS6D01G175800 chr7D 98.077 52 1 0 2207 2258 324206271 324206322 9.290000e-15 91.6
8 TraesCS6D01G175800 chr7B 97.750 2444 50 3 1 2440 742991047 742988605 0.000000e+00 4204.0
9 TraesCS6D01G175800 chr7B 97.669 2445 47 5 1 2440 716877179 716879618 0.000000e+00 4191.0
10 TraesCS6D01G175800 chr5B 100.000 147 0 0 2270 2416 316721508 316721362 3.090000e-69 272.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6D01G175800 chr6D 168754253 168756692 2439 True 4506 4506 100.000 1 2440 1 chr6D.!!$R2 2439
1 TraesCS6D01G175800 chr6D 124516686 124519124 2438 True 4261 4261 98.197 1 2440 1 chr6D.!!$R1 2439
2 TraesCS6D01G175800 chr7D 381923163 381925603 2440 True 4274 4274 98.279 1 2440 1 chr7D.!!$R3 2439
3 TraesCS6D01G175800 chr7D 382049243 382051681 2438 True 4244 4244 98.076 1 2440 1 chr7D.!!$R4 2439
4 TraesCS6D01G175800 chr7D 203499162 203501601 2439 True 4235 4235 97.994 1 2440 1 chr7D.!!$R1 2439
5 TraesCS6D01G175800 chr7D 381972168 381974599 2431 False 4222 4222 97.952 1 2440 1 chr7D.!!$F2 2439
6 TraesCS6D01G175800 chr7D 208634639 208636813 2174 True 3591 3591 96.468 1 2176 1 chr7D.!!$R2 2175
7 TraesCS6D01G175800 chr7B 742988605 742991047 2442 True 4204 4204 97.750 1 2440 1 chr7B.!!$R1 2439
8 TraesCS6D01G175800 chr7B 716877179 716879618 2439 False 4191 4191 97.669 1 2440 1 chr7B.!!$F1 2439

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
727 733 0.112412 AGGGCCCCACAAGTTGTTAG 59.888 55.0 21.43 0.54 0.0 2.34 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1533 1540 0.39113 CCGTTCCGAATGCTTCTCCA 60.391 55.0 0.0 0.0 0.0 3.86 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
128 129 0.558712 TAAGCCCCACAACCCAAAGT 59.441 50.000 0.00 0.00 0.00 2.66
129 130 0.558712 AAGCCCCACAACCCAAAGTA 59.441 50.000 0.00 0.00 0.00 2.24
263 264 3.242739 GCGCCCAAATCCGCTATATATTG 60.243 47.826 0.00 0.00 46.14 1.90
310 311 3.866651 ACTATGGCGAATGCATCTATCC 58.133 45.455 0.00 0.00 45.35 2.59
675 678 1.801302 TTGAGTCCGAGGGAGAGGGT 61.801 60.000 0.00 0.00 29.39 4.34
727 733 0.112412 AGGGCCCCACAAGTTGTTAG 59.888 55.000 21.43 0.54 0.00 2.34
731 737 2.583143 GCCCCACAAGTTGTTAGTTCT 58.417 47.619 5.57 0.00 0.00 3.01
732 738 2.956333 GCCCCACAAGTTGTTAGTTCTT 59.044 45.455 5.57 0.00 0.00 2.52
734 740 4.204012 CCCCACAAGTTGTTAGTTCTTCA 58.796 43.478 5.57 0.00 0.00 3.02
958 964 0.905357 AGTAGATGCCGAACCTGCTT 59.095 50.000 0.00 0.00 0.00 3.91
1354 1361 3.119352 GGAAGCTGCAGGGATTACAAAAG 60.119 47.826 17.12 0.00 0.00 2.27
1379 1386 2.340210 TGCTTTCCTGTGTTGCACTA 57.660 45.000 0.00 0.00 35.11 2.74
1533 1540 2.231478 TCTTCGCGAGAACTTCAGGATT 59.769 45.455 9.59 0.00 46.92 3.01
1778 1788 8.189460 GCTCTTTCTCTCTAAATTGCATCAAAT 58.811 33.333 0.00 0.00 0.00 2.32
2073 2095 4.787551 ACATATTCATTTTCACCGGGCTA 58.212 39.130 6.32 0.00 0.00 3.93
2076 2098 0.322322 TCATTTTCACCGGGCTACGT 59.678 50.000 6.32 0.00 42.24 3.57
2192 2214 0.881118 CGCCTTTGGAAGCTAAAGCA 59.119 50.000 4.54 0.00 45.16 3.91
2416 2438 3.326747 CCTTAGACTGACGGAACAAAGG 58.673 50.000 0.00 0.00 0.00 3.11
2422 2444 3.988517 GACTGACGGAACAAAGGTAAGAG 59.011 47.826 0.00 0.00 0.00 2.85
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
128 129 7.377766 AGCAAATTCTATTTGTTCTTCGCTA 57.622 32.000 12.26 0.00 0.00 4.26
129 130 6.259550 AGCAAATTCTATTTGTTCTTCGCT 57.740 33.333 12.26 0.00 0.00 4.93
675 678 0.250727 CTCGAGCCCCAAGAAAACCA 60.251 55.000 0.00 0.00 0.00 3.67
727 733 3.253432 GTGTGAATTCCCCAGTGAAGAAC 59.747 47.826 2.27 0.00 0.00 3.01
731 737 3.304911 TTGTGTGAATTCCCCAGTGAA 57.695 42.857 2.27 0.00 0.00 3.18
732 738 3.304911 TTTGTGTGAATTCCCCAGTGA 57.695 42.857 2.27 0.00 0.00 3.41
734 740 2.965147 CCTTTTGTGTGAATTCCCCAGT 59.035 45.455 2.27 0.00 0.00 4.00
908 914 6.614906 AGAGAGAATCCACTTCAGATAACCAT 59.385 38.462 0.00 0.00 36.24 3.55
1026 1032 5.522460 CGTTCTAATAAAGAATTCCGGCTCA 59.478 40.000 0.65 0.00 45.84 4.26
1067 1073 1.855599 AGGGGATAGCAGCATTCCTTT 59.144 47.619 12.13 0.81 0.00 3.11
1074 1080 3.550431 GCCGAGGGGATAGCAGCA 61.550 66.667 0.00 0.00 34.06 4.41
1255 1261 2.107378 TGTTTGAGCCTATGTTCACCCA 59.893 45.455 0.00 0.00 30.81 4.51
1354 1361 0.178990 AACACAGGAAAGCACCCTCC 60.179 55.000 0.00 0.00 0.00 4.30
1449 1456 5.975988 TTGCTAATCTTCCCCTCTAATGT 57.024 39.130 0.00 0.00 0.00 2.71
1451 1458 5.380900 GCTTTGCTAATCTTCCCCTCTAAT 58.619 41.667 0.00 0.00 0.00 1.73
1533 1540 0.391130 CCGTTCCGAATGCTTCTCCA 60.391 55.000 0.00 0.00 0.00 3.86
1778 1788 7.801104 TGCTCTCTCTCTCTCTCTCTATTTTA 58.199 38.462 0.00 0.00 0.00 1.52
1845 1861 8.591312 GTGACGAAGATCTTTCTTTTCTATCAG 58.409 37.037 9.87 0.00 42.34 2.90
2073 2095 1.140252 AGAAGTACCAAAGGTGCACGT 59.860 47.619 11.45 8.83 40.76 4.49
2076 2098 1.771854 TCCAGAAGTACCAAAGGTGCA 59.228 47.619 7.03 0.00 40.76 4.57
2192 2214 3.146847 CTCCCGGCTTTCTACAACTTTT 58.853 45.455 0.00 0.00 0.00 2.27
2416 2438 4.755266 TTCCATTCAGCCTACCTCTTAC 57.245 45.455 0.00 0.00 0.00 2.34


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.