Multiple sequence alignment - TraesCS6D01G175700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6D01G175700 chr6D 100.000 2306 0 0 1 2306 168265132 168267437 0.000000e+00 4259
1 TraesCS6D01G175700 chr6D 99.062 960 7 1 377 1334 389246899 389245940 0.000000e+00 1722
2 TraesCS6D01G175700 chr6D 98.554 968 13 1 1339 2306 168240976 168240010 0.000000e+00 1709
3 TraesCS6D01G175700 chr6D 98.140 968 17 1 1339 2306 398007716 398008682 0.000000e+00 1687
4 TraesCS6D01G175700 chr6D 97.844 371 8 0 1 371 389247429 389247059 1.930000e-180 641
5 TraesCS6D01G175700 chr5D 99.165 958 8 0 377 1334 503266380 503265423 0.000000e+00 1725
6 TraesCS6D01G175700 chr5D 99.062 960 7 1 377 1334 503244195 503245154 0.000000e+00 1722
7 TraesCS6D01G175700 chr5D 98.140 968 17 1 1339 2306 416566618 416565652 0.000000e+00 1687
8 TraesCS6D01G175700 chr5D 98.039 969 17 2 1339 2306 372564738 372565705 0.000000e+00 1683
9 TraesCS6D01G175700 chr5D 97.838 370 8 0 2 371 432433653 432434022 6.950000e-180 640
10 TraesCS6D01G175700 chr5D 97.574 371 9 0 1 371 503243665 503244035 8.990000e-179 636
11 TraesCS6D01G175700 chr3D 99.165 958 8 0 377 1334 589264601 589263644 0.000000e+00 1725
12 TraesCS6D01G175700 chr3D 98.244 968 16 1 1339 2306 459403968 459403002 0.000000e+00 1692
13 TraesCS6D01G175700 chr3A 99.166 959 7 1 377 1334 66006209 66005251 0.000000e+00 1725
14 TraesCS6D01G175700 chr3A 97.574 371 9 0 1 371 66006739 66006369 8.990000e-179 636
15 TraesCS6D01G175700 chr3A 97.574 371 9 0 1 371 672899128 672898758 8.990000e-179 636
16 TraesCS6D01G175700 chr2A 99.062 960 7 1 377 1334 726907532 726906573 0.000000e+00 1722
17 TraesCS6D01G175700 chr7B 98.958 960 8 1 377 1334 663100502 663099543 0.000000e+00 1716
18 TraesCS6D01G175700 chr7B 98.438 960 13 1 377 1334 662725327 662726286 0.000000e+00 1688
19 TraesCS6D01G175700 chr7B 97.844 371 8 0 1 371 663101032 663100662 1.930000e-180 641
20 TraesCS6D01G175700 chr7D 98.853 959 10 1 377 1334 231555502 231554544 0.000000e+00 1709
21 TraesCS6D01G175700 chr7D 98.113 371 7 0 1 371 77241810 77241440 0.000000e+00 647
22 TraesCS6D01G175700 chr2D 98.244 968 17 0 1339 2306 116549075 116550042 0.000000e+00 1694
23 TraesCS6D01G175700 chr2D 98.244 968 16 1 1339 2306 425576299 425575333 0.000000e+00 1692
24 TraesCS6D01G175700 chr1D 98.244 968 16 1 1339 2306 433360070 433359104 0.000000e+00 1692
25 TraesCS6D01G175700 chr1D 98.140 968 16 2 1339 2306 261963166 261964131 0.000000e+00 1687
26 TraesCS6D01G175700 chr1D 97.844 371 8 0 1 371 254383628 254383258 1.930000e-180 641
27 TraesCS6D01G175700 chrUn 98.113 371 7 0 1 371 216507725 216507355 0.000000e+00 647


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6D01G175700 chr6D 168265132 168267437 2305 False 4259.0 4259 100.000 1 2306 1 chr6D.!!$F1 2305
1 TraesCS6D01G175700 chr6D 168240010 168240976 966 True 1709.0 1709 98.554 1339 2306 1 chr6D.!!$R1 967
2 TraesCS6D01G175700 chr6D 398007716 398008682 966 False 1687.0 1687 98.140 1339 2306 1 chr6D.!!$F2 967
3 TraesCS6D01G175700 chr6D 389245940 389247429 1489 True 1181.5 1722 98.453 1 1334 2 chr6D.!!$R2 1333
4 TraesCS6D01G175700 chr5D 503265423 503266380 957 True 1725.0 1725 99.165 377 1334 1 chr5D.!!$R2 957
5 TraesCS6D01G175700 chr5D 416565652 416566618 966 True 1687.0 1687 98.140 1339 2306 1 chr5D.!!$R1 967
6 TraesCS6D01G175700 chr5D 372564738 372565705 967 False 1683.0 1683 98.039 1339 2306 1 chr5D.!!$F1 967
7 TraesCS6D01G175700 chr5D 503243665 503245154 1489 False 1179.0 1722 98.318 1 1334 2 chr5D.!!$F3 1333
8 TraesCS6D01G175700 chr3D 589263644 589264601 957 True 1725.0 1725 99.165 377 1334 1 chr3D.!!$R2 957
9 TraesCS6D01G175700 chr3D 459403002 459403968 966 True 1692.0 1692 98.244 1339 2306 1 chr3D.!!$R1 967
10 TraesCS6D01G175700 chr3A 66005251 66006739 1488 True 1180.5 1725 98.370 1 1334 2 chr3A.!!$R2 1333
11 TraesCS6D01G175700 chr2A 726906573 726907532 959 True 1722.0 1722 99.062 377 1334 1 chr2A.!!$R1 957
12 TraesCS6D01G175700 chr7B 662725327 662726286 959 False 1688.0 1688 98.438 377 1334 1 chr7B.!!$F1 957
13 TraesCS6D01G175700 chr7B 663099543 663101032 1489 True 1178.5 1716 98.401 1 1334 2 chr7B.!!$R1 1333
14 TraesCS6D01G175700 chr7D 231554544 231555502 958 True 1709.0 1709 98.853 377 1334 1 chr7D.!!$R2 957
15 TraesCS6D01G175700 chr2D 116549075 116550042 967 False 1694.0 1694 98.244 1339 2306 1 chr2D.!!$F1 967
16 TraesCS6D01G175700 chr2D 425575333 425576299 966 True 1692.0 1692 98.244 1339 2306 1 chr2D.!!$R1 967
17 TraesCS6D01G175700 chr1D 433359104 433360070 966 True 1692.0 1692 98.244 1339 2306 1 chr1D.!!$R2 967
18 TraesCS6D01G175700 chr1D 261963166 261964131 965 False 1687.0 1687 98.140 1339 2306 1 chr1D.!!$F1 967

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
480 635 0.046397 AAGGAGGGGGATGCCTAAGT 59.954 55.0 2.19 0.0 0.0 2.24 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1421 1581 0.256464 CCCCGGTAACTTAATGGGCA 59.744 55.0 0.0 0.0 38.6 5.36 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
19 20 1.572085 CGACTCGACCCGTGTAGTGT 61.572 60.000 0.00 0.0 33.78 3.55
95 96 1.800229 AAAGGAATTGACGGGGGCCT 61.800 55.000 0.84 0.0 0.00 5.19
371 372 1.380246 GGCCAAGTCATCATGCCCA 60.380 57.895 0.00 0.0 36.07 5.36
372 373 0.971959 GGCCAAGTCATCATGCCCAA 60.972 55.000 0.00 0.0 36.07 4.12
375 376 2.694628 GCCAAGTCATCATGCCCAATAA 59.305 45.455 0.00 0.0 0.00 1.40
480 635 0.046397 AAGGAGGGGGATGCCTAAGT 59.954 55.000 2.19 0.0 0.00 2.24
761 916 0.178975 TTTTTGGCGTCCCCATGTCT 60.179 50.000 0.00 0.0 44.89 3.41
1025 1180 3.616560 GCGTACTCCTCCTGTTTGAATCA 60.617 47.826 0.00 0.0 0.00 2.57
1298 1457 2.092914 ACGAGATCACCCCTTTCATTCC 60.093 50.000 0.00 0.0 0.00 3.01
1334 1493 3.872511 TCGTACCATTCGAGCCTTTTA 57.127 42.857 0.00 0.0 33.38 1.52
1335 1494 4.395959 TCGTACCATTCGAGCCTTTTAT 57.604 40.909 0.00 0.0 33.38 1.40
1336 1495 5.518848 TCGTACCATTCGAGCCTTTTATA 57.481 39.130 0.00 0.0 33.38 0.98
1337 1496 5.904941 TCGTACCATTCGAGCCTTTTATAA 58.095 37.500 0.00 0.0 33.38 0.98
1344 1503 6.990349 CCATTCGAGCCTTTTATAACTCCTTA 59.010 38.462 0.00 0.0 0.00 2.69
1421 1581 2.127708 CTTCCACCTAGGCCCACTAAT 58.872 52.381 9.30 0.0 37.29 1.73
1489 1650 2.500392 AAAATCCCGATTTCACCCGA 57.500 45.000 3.25 0.0 39.88 5.14
1730 1891 5.362263 GTCAATAACCAATAGCGGAACCTA 58.638 41.667 0.00 0.0 0.00 3.08
1752 1913 1.216064 TGCTCATATTGGCTCCCACT 58.784 50.000 0.00 0.0 30.78 4.00
1841 2002 3.382227 TGTTACTTGCCCGAGATTCGATA 59.618 43.478 0.00 0.0 43.74 2.92
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
14 15 2.995466 ACGCGTTAGCTACAACACTA 57.005 45.000 5.58 0.00 42.32 2.74
19 20 5.036737 GGATACTTAACGCGTTAGCTACAA 58.963 41.667 28.48 15.79 42.32 2.41
95 96 3.848301 ATGCTCCACCGCTTGTGCA 62.848 57.895 0.00 0.00 44.01 4.57
480 635 0.612174 ACTCCAGTCGCAAGCCTAGA 60.612 55.000 0.00 0.00 37.18 2.43
1205 1364 1.000506 GACGAACCTCAACCTGTGCTA 59.999 52.381 0.00 0.00 0.00 3.49
1298 1457 3.537874 GATCCCTCCGTCACCCCG 61.538 72.222 0.00 0.00 0.00 5.73
1421 1581 0.256464 CCCCGGTAACTTAATGGGCA 59.744 55.000 0.00 0.00 38.60 5.36
1489 1650 6.542370 CCTATGTTTGGATATCGGAAGTGTTT 59.458 38.462 0.00 0.00 0.00 2.83
1730 1891 2.060275 TGGGAGCCAATATGAGCATCT 58.940 47.619 0.54 0.00 34.92 2.90
1752 1913 8.843262 TGACCGATAAAGATCTTCGTAGAATAA 58.157 33.333 8.78 0.00 45.90 1.40


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.