Multiple sequence alignment - TraesCS6D01G175500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6D01G175500 chr6D 100.000 2141 0 0 1 2141 168255167 168257307 0 3954
1 TraesCS6D01G175500 chr5D 98.832 2141 25 0 1 2141 503218459 503220599 0 3816
2 TraesCS6D01G175500 chr5D 98.459 2141 33 0 1 2141 503277985 503275845 0 3771
3 TraesCS6D01G175500 chr5D 98.412 2141 34 0 1 2141 6189181 6191321 0 3766
4 TraesCS6D01G175500 chr1A 98.832 2141 25 0 1 2141 554512489 554514629 0 3816
5 TraesCS6D01G175500 chr3B 98.645 2141 29 0 1 2141 201527265 201529405 0 3794
6 TraesCS6D01G175500 chr3D 98.599 2141 27 2 1 2141 589279301 589277164 0 3784
7 TraesCS6D01G175500 chr3A 98.459 2141 31 2 1 2141 672909766 672907628 0 3770
8 TraesCS6D01G175500 chr3A 98.365 2141 34 1 1 2141 594899383 594897244 0 3759
9 TraesCS6D01G175500 chr2A 97.759 2142 46 2 1 2141 335838869 335841009 0 3688


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6D01G175500 chr6D 168255167 168257307 2140 False 3954 3954 100.000 1 2141 1 chr6D.!!$F1 2140
1 TraesCS6D01G175500 chr5D 503218459 503220599 2140 False 3816 3816 98.832 1 2141 1 chr5D.!!$F2 2140
2 TraesCS6D01G175500 chr5D 503275845 503277985 2140 True 3771 3771 98.459 1 2141 1 chr5D.!!$R1 2140
3 TraesCS6D01G175500 chr5D 6189181 6191321 2140 False 3766 3766 98.412 1 2141 1 chr5D.!!$F1 2140
4 TraesCS6D01G175500 chr1A 554512489 554514629 2140 False 3816 3816 98.832 1 2141 1 chr1A.!!$F1 2140
5 TraesCS6D01G175500 chr3B 201527265 201529405 2140 False 3794 3794 98.645 1 2141 1 chr3B.!!$F1 2140
6 TraesCS6D01G175500 chr3D 589277164 589279301 2137 True 3784 3784 98.599 1 2141 1 chr3D.!!$R1 2140
7 TraesCS6D01G175500 chr3A 672907628 672909766 2138 True 3770 3770 98.459 1 2141 1 chr3A.!!$R2 2140
8 TraesCS6D01G175500 chr3A 594897244 594899383 2139 True 3759 3759 98.365 1 2141 1 chr3A.!!$R1 2140
9 TraesCS6D01G175500 chr2A 335838869 335841009 2140 False 3688 3688 97.759 1 2141 1 chr2A.!!$F1 2140

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
927 929 0.811281 GGCGCTTTAACCATTCAGCT 59.189 50.0 7.64 0.0 0.0 4.24 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1739 1743 0.249489 CCGATCTTACCTTGGCTCGG 60.249 60.0 0.0 0.0 39.58 4.63 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
71 72 8.552296 CAATAGTATCTCCAATTATAGCCCCTT 58.448 37.037 0.00 0.0 0.00 3.95
540 541 3.305676 CCAGGTAGTCGATGGCTATTCAG 60.306 52.174 0.00 0.0 0.00 3.02
726 728 4.586421 CCTATGCTCTGAGTTCCAGTATCA 59.414 45.833 6.53 0.0 43.38 2.15
927 929 0.811281 GGCGCTTTAACCATTCAGCT 59.189 50.000 7.64 0.0 0.00 4.24
1165 1167 9.809096 GAGTTTGACTCATAGTGATCATTTCTA 57.191 33.333 0.00 0.0 44.45 2.10
1349 1351 4.044065 ACTTATTCCCAAACCTCATGTGGA 59.956 41.667 20.43 0.0 34.05 4.02
1739 1743 5.768164 TCTTCATAGACAAACTTGGGGTTTC 59.232 40.000 0.00 0.0 45.26 2.78
1762 1766 0.466124 GCCAAGGTAAGATCGGCTCT 59.534 55.000 0.00 0.0 39.73 4.09
2098 2102 5.293560 GCCTATTAGAAGTAGAAGGTGCTG 58.706 45.833 0.00 0.0 0.00 4.41
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
134 135 6.989155 AACCATAGAATACGACCCTAATCA 57.011 37.500 0.00 0.0 0.00 2.57
432 433 4.578928 CCCTTCAACCGGGTTATTCTATTG 59.421 45.833 12.95 0.0 36.91 1.90
540 541 3.412237 TTGGTGTTAAGGTGGTAGCTC 57.588 47.619 0.00 0.0 0.00 4.09
927 929 5.569428 CGATGATCCCTGTTAAGCATCCATA 60.569 44.000 0.00 0.0 31.02 2.74
1165 1167 6.670695 AACCAAGGTCATTCTTTGCTAAAT 57.329 33.333 0.00 0.0 32.75 1.40
1296 1298 8.650490 TGTCTGATAATGAGCAAGGAATATACA 58.350 33.333 0.00 0.0 0.00 2.29
1349 1351 9.226606 TGAGATGGTAAATGAAAACGATTAGTT 57.773 29.630 0.00 0.0 46.76 2.24
1739 1743 0.249489 CCGATCTTACCTTGGCTCGG 60.249 60.000 0.00 0.0 39.58 4.63
1762 1766 2.287584 AGAAAAGGGTCCCATGATCCA 58.712 47.619 11.55 0.0 45.01 3.41
1854 1858 3.310774 CCTGACACGATTGCCTCTTTATG 59.689 47.826 0.00 0.0 0.00 1.90
2098 2102 1.084289 GTCGGTAAGGATTGCACCAC 58.916 55.000 0.00 0.0 29.70 4.16


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.