Multiple sequence alignment - TraesCS6D01G175400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6D01G175400 chr6D 100.000 2162 0 0 1 2162 168254415 168256576 0 3993
1 TraesCS6D01G175400 chr3B 99.029 2162 21 0 1 2162 201526513 201528674 0 3877
2 TraesCS6D01G175400 chr3B 96.235 1275 45 3 888 2162 700786917 700785646 0 2085
3 TraesCS6D01G175400 chr1A 99.029 2162 21 0 1 2162 554511737 554513898 0 3877
4 TraesCS6D01G175400 chr5D 98.982 2162 22 0 1 2162 503217707 503219868 0 3871
5 TraesCS6D01G175400 chr5D 98.659 2162 29 0 1 2162 6188429 6190590 0 3832
6 TraesCS6D01G175400 chr5D 98.659 2162 29 0 1 2162 503278737 503276576 0 3832
7 TraesCS6D01G175400 chr3D 98.751 2162 24 2 1 2162 589280053 589277895 0 3840
8 TraesCS6D01G175400 chr2B 98.104 2162 36 2 1 2162 474907943 474910099 0 3760
9 TraesCS6D01G175400 chr2B 95.785 522 21 1 5 526 700452653 700453173 0 841
10 TraesCS6D01G175400 chr5A 97.735 2163 45 4 1 2162 619265860 619268019 0 3720


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6D01G175400 chr6D 168254415 168256576 2161 False 3993 3993 100.000 1 2162 1 chr6D.!!$F1 2161
1 TraesCS6D01G175400 chr3B 201526513 201528674 2161 False 3877 3877 99.029 1 2162 1 chr3B.!!$F1 2161
2 TraesCS6D01G175400 chr3B 700785646 700786917 1271 True 2085 2085 96.235 888 2162 1 chr3B.!!$R1 1274
3 TraesCS6D01G175400 chr1A 554511737 554513898 2161 False 3877 3877 99.029 1 2162 1 chr1A.!!$F1 2161
4 TraesCS6D01G175400 chr5D 503217707 503219868 2161 False 3871 3871 98.982 1 2162 1 chr5D.!!$F2 2161
5 TraesCS6D01G175400 chr5D 6188429 6190590 2161 False 3832 3832 98.659 1 2162 1 chr5D.!!$F1 2161
6 TraesCS6D01G175400 chr5D 503276576 503278737 2161 True 3832 3832 98.659 1 2162 1 chr5D.!!$R1 2161
7 TraesCS6D01G175400 chr3D 589277895 589280053 2158 True 3840 3840 98.751 1 2162 1 chr3D.!!$R1 2161
8 TraesCS6D01G175400 chr2B 474907943 474910099 2156 False 3760 3760 98.104 1 2162 1 chr2B.!!$F1 2161
9 TraesCS6D01G175400 chr2B 700452653 700453173 520 False 841 841 95.785 5 526 1 chr2B.!!$F2 521
10 TraesCS6D01G175400 chr5A 619265860 619268019 2159 False 3720 3720 97.735 1 2162 1 chr5A.!!$F1 2161

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
295 297 8.183104 TGTTATGATCTTCTACATCCTAGGTG 57.817 38.462 9.08 9.1 0.0 4.0 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1292 1298 3.412237 TTGGTGTTAAGGTGGTAGCTC 57.588 47.619 0.0 0.0 0.0 4.09 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
295 297 8.183104 TGTTATGATCTTCTACATCCTAGGTG 57.817 38.462 9.08 9.1 0.00 4.00
823 827 8.552296 CAATAGTATCTCCAATTATAGCCCCTT 58.448 37.037 0.00 0.0 0.00 3.95
1292 1298 3.305676 CCAGGTAGTCGATGGCTATTCAG 60.306 52.174 0.00 0.0 0.00 3.02
1478 1484 4.586421 CCTATGCTCTGAGTTCCAGTATCA 59.414 45.833 6.53 0.0 43.38 2.15
1679 1685 0.811281 GGCGCTTTAACCATTCAGCT 59.189 50.000 7.64 0.0 0.00 4.24
1917 1923 9.809096 GAGTTTGACTCATAGTGATCATTTCTA 57.191 33.333 0.00 0.0 44.45 2.10
2101 2107 4.044065 ACTTATTCCCAAACCTCATGTGGA 59.956 41.667 20.43 0.0 34.05 4.02
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
886 890 6.989155 AACCATAGAATACGACCCTAATCA 57.011 37.500 0.00 0.0 0.00 2.57
1184 1189 4.578928 CCCTTCAACCGGGTTATTCTATTG 59.421 45.833 12.95 0.0 36.91 1.90
1292 1298 3.412237 TTGGTGTTAAGGTGGTAGCTC 57.588 47.619 0.00 0.0 0.00 4.09
1679 1685 5.569428 CGATGATCCCTGTTAAGCATCCATA 60.569 44.000 0.00 0.0 31.02 2.74
1917 1923 6.670695 AACCAAGGTCATTCTTTGCTAAAT 57.329 33.333 0.00 0.0 32.75 1.40
2101 2107 9.226606 TGAGATGGTAAATGAAAACGATTAGTT 57.773 29.630 0.00 0.0 46.76 2.24


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.