Multiple sequence alignment - TraesCS6D01G175100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6D01G175100 chr6D 100.000 2450 0 0 1 2450 168251063 168248614 0.000000e+00 4525
1 TraesCS6D01G175100 chrUn 98.982 2456 18 4 1 2450 93410106 93412560 0.000000e+00 4390
2 TraesCS6D01G175100 chr2D 98.779 2457 20 7 1 2450 272794368 272796821 0.000000e+00 4362
3 TraesCS6D01G175100 chr5D 98.616 2456 25 6 1 2450 503217743 503215291 0.000000e+00 4338
4 TraesCS6D01G175100 chr5D 97.754 2360 42 9 97 2450 329120677 329123031 0.000000e+00 4054
5 TraesCS6D01G175100 chr3A 97.761 2456 47 6 1 2450 672910482 672912935 0.000000e+00 4224
6 TraesCS6D01G175100 chr6A 97.398 2460 48 11 1 2450 260116755 260119208 0.000000e+00 4174
7 TraesCS6D01G175100 chr7A 94.951 2456 107 11 1 2450 352182288 352184732 0.000000e+00 3832
8 TraesCS6D01G175100 chr2A 97.851 1768 34 4 577 2344 335829841 335828078 0.000000e+00 3051
9 TraesCS6D01G175100 chr2A 96.920 974 15 2 1 972 335838153 335837193 0.000000e+00 1618
10 TraesCS6D01G175100 chr2A 99.061 213 2 0 15 227 713027374 713027586 1.370000e-102 383
11 TraesCS6D01G175100 chr2A 98.438 128 1 1 549 676 588452219 588452093 8.820000e-55 224
12 TraesCS6D01G175100 chr2A 94.030 67 1 2 396 460 703332721 703332656 5.580000e-17 99
13 TraesCS6D01G175100 chr1D 95.447 1757 62 9 702 2450 397109208 397110954 0.000000e+00 2785


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6D01G175100 chr6D 168248614 168251063 2449 True 4525 4525 100.000 1 2450 1 chr6D.!!$R1 2449
1 TraesCS6D01G175100 chrUn 93410106 93412560 2454 False 4390 4390 98.982 1 2450 1 chrUn.!!$F1 2449
2 TraesCS6D01G175100 chr2D 272794368 272796821 2453 False 4362 4362 98.779 1 2450 1 chr2D.!!$F1 2449
3 TraesCS6D01G175100 chr5D 503215291 503217743 2452 True 4338 4338 98.616 1 2450 1 chr5D.!!$R1 2449
4 TraesCS6D01G175100 chr5D 329120677 329123031 2354 False 4054 4054 97.754 97 2450 1 chr5D.!!$F1 2353
5 TraesCS6D01G175100 chr3A 672910482 672912935 2453 False 4224 4224 97.761 1 2450 1 chr3A.!!$F1 2449
6 TraesCS6D01G175100 chr6A 260116755 260119208 2453 False 4174 4174 97.398 1 2450 1 chr6A.!!$F1 2449
7 TraesCS6D01G175100 chr7A 352182288 352184732 2444 False 3832 3832 94.951 1 2450 1 chr7A.!!$F1 2449
8 TraesCS6D01G175100 chr2A 335828078 335829841 1763 True 3051 3051 97.851 577 2344 1 chr2A.!!$R1 1767
9 TraesCS6D01G175100 chr2A 335837193 335838153 960 True 1618 1618 96.920 1 972 1 chr2A.!!$R2 971
10 TraesCS6D01G175100 chr1D 397109208 397110954 1746 False 2785 2785 95.447 702 2450 1 chr1D.!!$F1 1748

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
864 873 1.274728 CAAATTGGGGGAATTCGTGCA 59.725 47.619 0.0 0.0 32.76 4.57 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1927 1950 6.986817 GCAAGAATGTTAGGCTGTCTATAAGA 59.013 38.462 0.0 0.0 0.0 2.1 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
185 186 1.996798 TTGGGTAGAGCCGGATCTAG 58.003 55.000 29.1 0.0 38.44 2.43
269 270 2.754375 GGGCGGTGAAGGGAAAGA 59.246 61.111 0.0 0.0 0.00 2.52
864 873 1.274728 CAAATTGGGGGAATTCGTGCA 59.725 47.619 0.0 0.0 32.76 4.57
1480 1496 4.883083 TCCATCTAAGATTTCGATTCCCG 58.117 43.478 0.0 0.0 40.25 5.14
1671 1692 5.838521 ACAAAAGAATAGGAAAAAGGGCTCA 59.161 36.000 0.0 0.0 0.00 4.26
1746 1767 4.713792 AATGGACTCAGGTTCAAGTTCT 57.286 40.909 0.0 0.0 34.22 3.01
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
185 186 0.800631 GCGTTTACCTAGCCAACACC 59.199 55.000 0.0 0.0 0.0 4.16
656 664 4.191544 TGATGAGCTACAAAAGGATTCGG 58.808 43.478 0.0 0.0 0.0 4.30
1927 1950 6.986817 GCAAGAATGTTAGGCTGTCTATAAGA 59.013 38.462 0.0 0.0 0.0 2.10


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.