Multiple sequence alignment - TraesCS6D01G175000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6D01G175000 chr6D 100.000 2720 0 0 1 2720 168250556 168247837 0 5024
1 TraesCS6D01G175000 chrUn 98.972 2724 22 4 1 2720 93410614 93413335 0 4870
2 TraesCS6D01G175000 chr5D 98.678 2724 27 7 1 2720 503217234 503214516 0 4822
3 TraesCS6D01G175000 chr5D 97.614 2724 52 11 1 2720 329121090 329123804 0 4658
4 TraesCS6D01G175000 chr2D 98.459 2725 29 11 1 2720 272794877 272797593 0 4787
5 TraesCS6D01G175000 chr3B 97.736 2738 39 9 1 2720 201526040 201523308 0 4691
6 TraesCS6D01G175000 chr3A 97.760 2723 53 7 1 2720 672910992 672913709 0 4684
7 TraesCS6D01G175000 chr6A 97.544 2728 51 12 1 2720 260117264 260119983 0 4652
8 TraesCS6D01G175000 chr6A 97.092 2098 51 7 628 2720 271188163 271186071 0 3528
9 TraesCS6D01G175000 chr7A 94.609 2727 120 18 1 2720 352182796 352185502 0 4196
10 TraesCS6D01G175000 chr4D 97.633 2028 40 8 696 2720 19927118 19925096 0 3472
11 TraesCS6D01G175000 chr7D 98.913 1196 10 3 1 1194 231547609 231546415 0 2134


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6D01G175000 chr6D 168247837 168250556 2719 True 5024 5024 100.000 1 2720 1 chr6D.!!$R1 2719
1 TraesCS6D01G175000 chrUn 93410614 93413335 2721 False 4870 4870 98.972 1 2720 1 chrUn.!!$F1 2719
2 TraesCS6D01G175000 chr5D 503214516 503217234 2718 True 4822 4822 98.678 1 2720 1 chr5D.!!$R1 2719
3 TraesCS6D01G175000 chr5D 329121090 329123804 2714 False 4658 4658 97.614 1 2720 1 chr5D.!!$F1 2719
4 TraesCS6D01G175000 chr2D 272794877 272797593 2716 False 4787 4787 98.459 1 2720 1 chr2D.!!$F1 2719
5 TraesCS6D01G175000 chr3B 201523308 201526040 2732 True 4691 4691 97.736 1 2720 1 chr3B.!!$R1 2719
6 TraesCS6D01G175000 chr3A 672910992 672913709 2717 False 4684 4684 97.760 1 2720 1 chr3A.!!$F1 2719
7 TraesCS6D01G175000 chr6A 260117264 260119983 2719 False 4652 4652 97.544 1 2720 1 chr6A.!!$F1 2719
8 TraesCS6D01G175000 chr6A 271186071 271188163 2092 True 3528 3528 97.092 628 2720 1 chr6A.!!$R1 2092
9 TraesCS6D01G175000 chr7A 352182796 352185502 2706 False 4196 4196 94.609 1 2720 1 chr7A.!!$F1 2719
10 TraesCS6D01G175000 chr4D 19925096 19927118 2022 True 3472 3472 97.633 696 2720 1 chr4D.!!$R1 2024
11 TraesCS6D01G175000 chr7D 231546415 231547609 1194 True 2134 2134 98.913 1 1194 1 chr7D.!!$R1 1193

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
357 362 1.274728 CAAATTGGGGGAATTCGTGCA 59.725 47.619 0.0 0.0 32.76 4.57 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2113 2159 5.51052 CCTCTTCCTTCTTTCTATCATCCCG 60.511 48.0 0.0 0.0 0.0 5.14 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
357 362 1.274728 CAAATTGGGGGAATTCGTGCA 59.725 47.619 0.00 0.0 32.76 4.57
973 1001 4.883083 TCCATCTAAGATTTCGATTCCCG 58.117 43.478 0.00 0.0 40.25 5.14
1239 1269 4.713792 AATGGACTCAGGTTCAAGTTCT 57.286 40.909 0.00 0.0 34.22 3.01
2113 2159 2.755952 AAGGGATGTGGATAAAGGGC 57.244 50.000 0.00 0.0 0.00 5.19
2315 2361 6.517027 GCCCGGGTTAATAAAACTGAGAAAAA 60.517 38.462 24.63 0.0 29.28 1.94
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1420 1452 6.986817 GCAAGAATGTTAGGCTGTCTATAAGA 59.013 38.462 0.0 0.0 0.0 2.10
2113 2159 5.510520 CCTCTTCCTTCTTTCTATCATCCCG 60.511 48.000 0.0 0.0 0.0 5.14


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.