Multiple sequence alignment - TraesCS6D01G174900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6D01G174900 chr6D 100.000 2372 0 0 1 2372 168248125 168245754 0.000000e+00 4381.0
1 TraesCS6D01G174900 chr5D 97.960 2402 15 8 1 2372 560881398 560879001 0.000000e+00 4133.0
2 TraesCS6D01G174900 chr5D 96.664 2398 21 11 1 2372 503214804 503212440 0.000000e+00 3930.0
3 TraesCS6D01G174900 chr5D 96.866 2138 33 10 1 2131 329123517 329125627 0.000000e+00 3546.0
4 TraesCS6D01G174900 chrUn 97.876 2401 16 8 1 2369 93415415 93417812 0.000000e+00 4119.0
5 TraesCS6D01G174900 chrUn 99.168 1082 7 2 1 1081 93413047 93414127 0.000000e+00 1947.0
6 TraesCS6D01G174900 chr2D 97.667 2400 20 13 1 2372 272797308 272799699 0.000000e+00 4089.0
7 TraesCS6D01G174900 chr2D 99.274 1239 6 3 1 1237 635585967 635587204 0.000000e+00 2235.0
8 TraesCS6D01G174900 chr3B 97.044 2402 29 13 1 2372 201523596 201521207 0.000000e+00 4004.0
9 TraesCS6D01G174900 chr3B 86.391 169 13 2 2204 2372 822007720 822007878 2.420000e-40 176.0
10 TraesCS6D01G174900 chr3B 88.435 147 8 1 2226 2372 822023036 822023173 4.050000e-38 169.0
11 TraesCS6D01G174900 chr6A 96.695 2390 49 13 1 2372 271186359 271183982 0.000000e+00 3949.0
12 TraesCS6D01G174900 chr7B 96.749 2338 47 10 48 2372 559141856 559139535 0.000000e+00 3869.0
13 TraesCS6D01G174900 chr1A 95.692 2066 50 16 327 2372 168442037 168444083 0.000000e+00 3286.0
14 TraesCS6D01G174900 chr1D 98.284 1573 17 3 1 1565 254522655 254521085 0.000000e+00 2747.0
15 TraesCS6D01G174900 chr1D 97.346 1281 7 7 1118 2372 144238516 144237237 0.000000e+00 2152.0
16 TraesCS6D01G174900 chr3D 99.497 1392 7 0 1 1392 24168397 24167006 0.000000e+00 2532.0
17 TraesCS6D01G174900 chr3D 88.421 95 3 1 2278 2372 107088961 107089047 8.960000e-20 108.0
18 TraesCS6D01G174900 chr4A 96.612 1269 16 8 1126 2372 722779092 722780355 0.000000e+00 2080.0
19 TraesCS6D01G174900 chr7D 98.687 533 6 1 669 1200 77233193 77233725 0.000000e+00 944.0
20 TraesCS6D01G174900 chr7D 95.652 115 3 1 2258 2372 231603007 231602895 1.450000e-42 183.0
21 TraesCS6D01G174900 chr6B 96.522 115 3 1 2258 2372 420839920 420839807 3.110000e-44 189.0
22 TraesCS6D01G174900 chr2B 85.593 118 7 1 2255 2372 495355907 495356014 5.360000e-22 115.0
23 TraesCS6D01G174900 chr2A 86.316 95 3 3 2277 2370 710270281 710270196 6.980000e-16 95.3


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6D01G174900 chr6D 168245754 168248125 2371 True 4381 4381 100.000 1 2372 1 chr6D.!!$R1 2371
1 TraesCS6D01G174900 chr5D 560879001 560881398 2397 True 4133 4133 97.960 1 2372 1 chr5D.!!$R2 2371
2 TraesCS6D01G174900 chr5D 503212440 503214804 2364 True 3930 3930 96.664 1 2372 1 chr5D.!!$R1 2371
3 TraesCS6D01G174900 chr5D 329123517 329125627 2110 False 3546 3546 96.866 1 2131 1 chr5D.!!$F1 2130
4 TraesCS6D01G174900 chrUn 93413047 93417812 4765 False 3033 4119 98.522 1 2369 2 chrUn.!!$F1 2368
5 TraesCS6D01G174900 chr2D 272797308 272799699 2391 False 4089 4089 97.667 1 2372 1 chr2D.!!$F1 2371
6 TraesCS6D01G174900 chr2D 635585967 635587204 1237 False 2235 2235 99.274 1 1237 1 chr2D.!!$F2 1236
7 TraesCS6D01G174900 chr3B 201521207 201523596 2389 True 4004 4004 97.044 1 2372 1 chr3B.!!$R1 2371
8 TraesCS6D01G174900 chr6A 271183982 271186359 2377 True 3949 3949 96.695 1 2372 1 chr6A.!!$R1 2371
9 TraesCS6D01G174900 chr7B 559139535 559141856 2321 True 3869 3869 96.749 48 2372 1 chr7B.!!$R1 2324
10 TraesCS6D01G174900 chr1A 168442037 168444083 2046 False 3286 3286 95.692 327 2372 1 chr1A.!!$F1 2045
11 TraesCS6D01G174900 chr1D 254521085 254522655 1570 True 2747 2747 98.284 1 1565 1 chr1D.!!$R2 1564
12 TraesCS6D01G174900 chr1D 144237237 144238516 1279 True 2152 2152 97.346 1118 2372 1 chr1D.!!$R1 1254
13 TraesCS6D01G174900 chr3D 24167006 24168397 1391 True 2532 2532 99.497 1 1392 1 chr3D.!!$R1 1391
14 TraesCS6D01G174900 chr4A 722779092 722780355 1263 False 2080 2080 96.612 1126 2372 1 chr4A.!!$F1 1246
15 TraesCS6D01G174900 chr7D 77233193 77233725 532 False 944 944 98.687 669 1200 1 chr7D.!!$F1 531

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
787 3169 7.838771 AAACCTGGTCGTATACTTTATGAAC 57.161 36.0 0.0 0.0 0.0 3.18 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2066 4485 2.243736 GGAACATTCCATTGGGTAGGGA 59.756 50.0 5.75 0.0 46.76 4.2 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
787 3169 7.838771 AAACCTGGTCGTATACTTTATGAAC 57.161 36.000 0.00 0.0 0.00 3.18
2066 4485 8.631480 AACTTTCGAAGGTTTAGTTATGGAAT 57.369 30.769 18.86 0.0 0.00 3.01
2196 4615 7.610305 GGATAGGGTCAAAATTGAAGTAAGTCA 59.390 37.037 0.00 0.0 39.21 3.41
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1565 3978 7.677454 TTGTAGATACTACTCGAACTGTTCA 57.323 36.00 19.56 6.87 0.00 3.18
2061 4480 2.295269 TCCATTGGGTAGGGATTCCA 57.705 50.00 4.80 0.00 33.20 3.53
2066 4485 2.243736 GGAACATTCCATTGGGTAGGGA 59.756 50.00 5.75 0.00 46.76 4.20
2196 4615 4.526970 ACGTCCCTTGCTTGAATCATAAT 58.473 39.13 0.00 0.00 0.00 1.28
2270 4689 7.297936 TGGTATCCTTCAAATCTTCGCTATA 57.702 36.00 0.00 0.00 0.00 1.31


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.