AutoCloner

Multiple sequence alignment - TraesCS6D01G171400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)

BLAST Results

Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

	qseqid	sseqid	percentage.identical	alignment.length	no.mismatch	no.gap.openings	qstart	qend	sstart	send	evalue	bitscore
0	TraesCS6D01G171400	chr6D	100.000	6122	0	0	1	6122	157820234	157814113	0.000000e+00	11306.0
1	TraesCS6D01G171400	chr6D	96.238	505	19	0	1	505	157841094	157840590	0.000000e+00	828.0
2	TraesCS6D01G171400	chr6D	95.517	513	19	3	1	512	208005911	208005402	0.000000e+00	817.0
3	TraesCS6D01G171400	chr6D	96.040	505	15	3	1	505	208018552	208018053	0.000000e+00	817.0
4	TraesCS6D01G171400	chr6D	94.444	90	3	2	4029	4118	468057621	468057708	2.980000e-28	137.0
5	TraesCS6D01G171400	chr6B	92.948	2269	118	27	3263	5507	287149905	287147655	0.000000e+00	3265.0
6	TraesCS6D01G171400	chr6B	92.934	1486	58	29	805	2281	287151996	287150549	0.000000e+00	2119.0
7	TraesCS6D01G171400	chr6B	95.448	659	28	2	2506	3163	287150545	287149888	0.000000e+00	1050.0
8	TraesCS6D01G171400	chr6B	98.058	103	2	0	3151	3253	68108856	68108958	4.880000e-41	180.0
9	TraesCS6D01G171400	chr6B	82.178	101	15	3	5749	5847	337939234	337939333	3.930000e-12	84.2
10	TraesCS6D01G171400	chr6A	91.566	2229	90	43	814	2994	214176278	214178456	0.000000e+00	2985.0
11	TraesCS6D01G171400	chr6A	93.108	1422	71	12	4095	5507	214179649	214181052	0.000000e+00	2058.0
12	TraesCS6D01G171400	chr6A	94.084	693	36	4	3360	4051	214178838	214179526	0.000000e+00	1048.0
13	TraesCS6D01G171400	chr6A	93.750	176	9	2	2989	3163	214178614	214178788	4.710000e-66	263.0
14	TraesCS6D01G171400	chr6A	96.364	110	3	1	3144	3253	379824680	379824788	4.880000e-41	180.0
15	TraesCS6D01G171400	chr6A	95.455	88	4	0	718	805	214157020	214157107	2.300000e-29	141.0
16	TraesCS6D01G171400	chr6A	91.139	79	5	1	640	716	214156631	214156709	8.390000e-19	106.0
17	TraesCS6D01G171400	chr3D	96.252	507	19	0	1	507	422234130	422233624	0.000000e+00	832.0
18	TraesCS6D01G171400	chr3D	96.238	505	19	0	1	505	332098788	332098284	0.000000e+00	828.0
19	TraesCS6D01G171400	chr3D	96.238	505	19	0	1	505	422252285	422251781	0.000000e+00	828.0
20	TraesCS6D01G171400	chr3D	95.678	509	18	3	1	505	187017569	187018077	0.000000e+00	815.0
21	TraesCS6D01G171400	chr3D	95.652	506	20	2	1	506	332085571	332085068	0.000000e+00	811.0
22	TraesCS6D01G171400	chr3D	86.875	160	14	7	5965	6122	134002647	134002493	8.160000e-39	172.0
23	TraesCS6D01G171400	chr3D	82.192	146	24	2	5967	6112	414776400	414776257	2.320000e-24	124.0
24	TraesCS6D01G171400	chr3D	90.323	93	8	1	4030	4122	509255110	509255201	3.000000e-23	121.0
25	TraesCS6D01G171400	chr3D	88.043	92	11	0	5522	5613	582810462	582810371	6.490000e-20	110.0
26	TraesCS6D01G171400	chr5D	95.652	506	19	2	2	505	366941584	366942088	0.000000e+00	809.0
27	TraesCS6D01G171400	chr5D	100.000	98	0	0	3156	3253	362064381	362064478	1.360000e-41	182.0
28	TraesCS6D01G171400	chr5D	83.007	153	26	0	5965	6117	71549817	71549969	8.270000e-29	139.0
29	TraesCS6D01G171400	chr5D	85.000	100	15	0	5535	5634	314916204	314916303	1.090000e-17	102.0
30	TraesCS6D01G171400	chr7A	90.775	271	23	2	1069	1337	538689365	538689635	1.620000e-95	361.0
31	TraesCS6D01G171400	chr7A	80.402	398	55	17	4809	5187	538694718	538695111	1.300000e-71	281.0
32	TraesCS6D01G171400	chr7A	93.162	117	5	3	3139	3253	121145332	121145447	1.060000e-37	169.0
33	TraesCS6D01G171400	chr7A	82.243	107	14	5	5750	5852	194170055	194169950	3.040000e-13	87.9
34	TraesCS6D01G171400	chr7D	89.781	274	26	2	1069	1340	461546952	461546679	3.510000e-92	350.0
35	TraesCS6D01G171400	chr7D	79.899	398	57	17	4809	5187	461541599	461541206	2.810000e-68	270.0
36	TraesCS6D01G171400	chr7D	82.237	152	24	2	5963	6112	544099043	544099193	1.790000e-25	128.0
37	TraesCS6D01G171400	chr7B	89.781	274	26	2	1069	1340	483921304	483921031	3.510000e-92	350.0
38	TraesCS6D01G171400	chr7B	89.655	203	20	1	4809	5010	483914993	483914791	2.190000e-64	257.0
39	TraesCS6D01G171400	chr1D	90.728	151	12	2	5967	6117	276241055	276241203	3.740000e-47	200.0
40	TraesCS6D01G171400	chr1D	84.000	100	15	1	5749	5847	254602903	254603002	1.820000e-15	95.3
41	TraesCS6D01G171400	chr3B	100.000	98	0	0	3156	3253	48667411	48667314	1.360000e-41	182.0
42	TraesCS6D01G171400	chr3B	86.207	116	16	0	5506	5621	43732649	43732764	6.440000e-25	126.0
43	TraesCS6D01G171400	chr3B	88.073	109	8	3	5505	5609	202473028	202472921	2.320000e-24	124.0
44	TraesCS6D01G171400	chr3B	89.362	94	9	1	4033	4126	237977332	237977240	3.880000e-22	117.0
45	TraesCS6D01G171400	chr2A	98.095	105	1	1	3150	3253	87864114	87864010	1.360000e-41	182.0
46	TraesCS6D01G171400	chr2A	91.111	90	7	1	4033	4122	568412790	568412702	3.000000e-23	121.0
47	TraesCS6D01G171400	chr5B	99.010	101	0	1	3153	3253	291064304	291064205	4.880000e-41	180.0
48	TraesCS6D01G171400	chr5B	96.296	108	2	2	3148	3253	254546045	254545938	6.310000e-40	176.0
49	TraesCS6D01G171400	chr5B	88.430	121	12	2	5502	5621	336038140	336038259	1.780000e-30	145.0
50	TraesCS6D01G171400	chr5B	83.333	108	17	1	3667	3774	638839042	638838936	1.400000e-16	99.0
51	TraesCS6D01G171400	chr5B	81.818	110	15	5	5748	5852	184296030	184295921	3.040000e-13	87.9
52	TraesCS6D01G171400	chr2D	97.143	105	1	2	3150	3253	364091314	364091417	6.310000e-40	176.0
53	TraesCS6D01G171400	chr2D	83.019	159	24	3	5964	6122	639202730	639202885	2.300000e-29	141.0
54	TraesCS6D01G171400	chr2D	89.655	87	9	0	5535	5621	545854916	545855002	1.800000e-20	111.0
55	TraesCS6D01G171400	chr1A	84.049	163	24	2	5960	6122	12252658	12252498	8.220000e-34	156.0
56	TraesCS6D01G171400	chr1A	82.432	148	23	3	5967	6112	164525327	164525181	6.440000e-25	126.0
57	TraesCS6D01G171400	chr1A	83.673	98	13	3	5752	5847	326200808	326200904	8.450000e-14	89.8
58	TraesCS6D01G171400	chr4D	94.505	91	4	1	4033	4123	53246168	53246079	8.270000e-29	139.0
59	TraesCS6D01G171400	chr5A	88.136	118	8	5	5506	5620	83272534	83272420	1.070000e-27	135.0
60	TraesCS6D01G171400	chr5A	87.179	117	15	0	5505	5621	54755691	54755807	3.850000e-27	134.0
61	TraesCS6D01G171400	chr5A	82.550	149	22	4	5965	6112	586673138	586672993	1.790000e-25	128.0
62	TraesCS6D01G171400	chr5A	84.259	108	16	1	3667	3774	635774493	635774599	3.020000e-18	104.0
63	TraesCS6D01G171400	chr2B	95.349	86	3	1	4033	4118	108996596	108996512	1.070000e-27	135.0
64	TraesCS6D01G171400	chr2B	81.373	102	16	3	5748	5847	494165534	494165634	5.090000e-11	80.5
65	TraesCS6D01G171400	chr4A	94.253	87	3	2	4033	4118	742454518	742454433	1.380000e-26	132.0
66	TraesCS6D01G171400	chr3A	85.714	119	15	2	5504	5621	716749123	716749006	2.320000e-24	124.0
67	TraesCS6D01G171400	chr3A	88.406	69	6	2	5847	5913	405994836	405994768	1.410000e-11	82.4
68	TraesCS6D01G171400	chr1B	93.023	86	5	1	4033	4118	64776427	64776343	2.320000e-24	124.0
69	TraesCS6D01G171400	chr1B	88.776	98	7	4	4030	4126	349741742	349741648	3.880000e-22	117.0
70	TraesCS6D01G171400	chr1B	81.132	106	15	5	5751	5852	661570267	661570163	5.090000e-11	80.5
71	TraesCS6D01G171400	chr4B	82.178	101	17	1	5748	5847	122560471	122560571	1.090000e-12	86.1
72	TraesCS6D01G171400	chr4B	81.308	107	15	5	5750	5852	54040767	54040662	1.410000e-11	82.4

These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

	query	scaffold	start	end	length	rev.comp	avg.bitscore	max.bitscore	avg.percent.identical	query.start	query.end	num_hsp	groupid	homo_length
0	TraesCS6D01G171400	chr6D	157814113	157820234	6121	True	11306.000000	11306	100.000000	1	6122	1	chr6D.!!$R1	6121
1	TraesCS6D01G171400	chr6D	157840590	157841094	504	True	828.000000	828	96.238000	1	505	1	chr6D.!!$R2	504
2	TraesCS6D01G171400	chr6D	208005402	208005911	509	True	817.000000	817	95.517000	1	512	1	chr6D.!!$R3	511
3	TraesCS6D01G171400	chr6B	287147655	287151996	4341	True	2144.666667	3265	93.776667	805	5507	3	chr6B.!!$R1	4702
4	TraesCS6D01G171400	chr6A	214176278	214181052	4774	False	1588.500000	2985	93.127000	814	5507	4	chr6A.!!$F3	4693
5	TraesCS6D01G171400	chr3D	422233624	422234130	506	True	832.000000	832	96.252000	1	507	1	chr3D.!!$R5	506
6	TraesCS6D01G171400	chr3D	332098284	332098788	504	True	828.000000	828	96.238000	1	505	1	chr3D.!!$R3	504
7	TraesCS6D01G171400	chr3D	422251781	422252285	504	True	828.000000	828	96.238000	1	505	1	chr3D.!!$R6	504
8	TraesCS6D01G171400	chr3D	187017569	187018077	508	False	815.000000	815	95.678000	1	505	1	chr3D.!!$F1	504
9	TraesCS6D01G171400	chr3D	332085068	332085571	503	True	811.000000	811	95.652000	1	506	1	chr3D.!!$R2	505
10	TraesCS6D01G171400	chr5D	366941584	366942088	504	False	809.000000	809	95.652000	2	505	1	chr5D.!!$F4	503

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)

Position	MSA Position	Penalty	Sequence	TM	GC	Self any TH	Self end TH	Hairpin	End Stability	Orientation
511	517	0.036765	TAGAACCACGACATGCCCAC	60.037	55.000	0.00	0.00	0.00	4.61	F
578	584	0.038526	ACGCTCAACCGTTCCACTAG	60.039	55.000	0.00	0.00	38.47	2.57	F
582	588	0.038892	TCAACCGTTCCACTAGACGC	60.039	55.000	0.00	0.00	37.91	5.19	F
710	716	0.109597	GCAGCTGCGTTTAAGCATGT	60.110	50.000	25.23	0.00	46.97	3.21	F
761	767	0.112995	TCCAGCCATTTTGACCAGCT	59.887	50.000	0.00	0.00	0.00	4.24	F
803	809	0.178975	ACAGTCCGCCCATTCCAAAA	60.179	50.000	0.00	0.00	0.00	2.44	F
818	824	1.339610	CCAAAACCACCAATTCGCAGA	59.660	47.619	0.00	0.00	0.00	4.26	F
1807	1837	1.531149	ACAATTTCCGCAAGACGTGAG	59.469	47.619	0.00	0.00	41.42	3.51	F
2133	2163	1.568504	TGAGTACTTCCCCGCTTGAT	58.431	50.000	0.00	0.00	0.00	2.57	F
2284	2319	2.092484	TGCACTATGGCTAAGGCAATGA	60.092	45.455	0.00	0.00	42.43	2.57	F
3229	3457	0.714180	TTGGGGTAGGCTAGAGGTGA	59.286	55.000	0.00	0.00	0.00	4.02	F
3695	3924	0.706433	AAGGGCCCATGTGTGATCTT	59.294	50.000	27.56	1.34	0.00	2.40	F

Position	MSA Position	Penalty	Sequence	TM	GC	Self any TH	Self end TH	Hairpin	End Stability	Orientation
1550	1569	0.107017	AGCACAGGATACCACCATGC	60.107	55.000	0.00	0.00	41.48	4.06	R
1556	1575	0.830648	GTAGCCAGCACAGGATACCA	59.169	55.000	6.94	0.00	43.10	3.25	R
1788	1818	1.135972	CCTCACGTCTTGCGGAAATTG	60.136	52.381	0.00	0.00	46.52	2.32	R
2698	2762	2.073117	TTCGCAAGCACTCGTCATAA	57.927	45.000	0.00	0.00	37.18	1.90	R
2810	2874	5.506686	TGCACTAGTTGTACAAAATTGCA	57.493	34.783	22.63	22.63	35.19	4.08	R
2812	2876	4.917415	GCCTGCACTAGTTGTACAAAATTG	59.083	41.667	10.51	7.42	0.00	2.32	R
3029	3256	0.532862	ATAGCAAAGATCGCCACCCG	60.533	55.000	0.00	0.00	38.61	5.28	R
3210	3438	0.714180	TCACCTCTAGCCTACCCCAA	59.286	55.000	0.00	0.00	0.00	4.12	R
3211	3439	0.714180	TTCACCTCTAGCCTACCCCA	59.286	55.000	0.00	0.00	0.00	4.96	R
3238	3466	0.824109	TCGGATTGGTTGCGAGATCT	59.176	50.000	0.00	0.00	43.76	2.75	R
4839	5160	0.441145	GGTAACAGTAGTTTGGCGCG	59.559	55.000	0.00	0.00	39.15	6.86	R
5826	6148	0.036732	TGTGCCCCTACTGCAGAAAG	59.963	55.000	23.35	16.57	39.87	2.62	R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)

Show entries

Search:

Position	MSA Position	Penalty	Sequence	TM	GC	Self any TH	Self end TH	Hairpin	End Stability
86	87	3.639094	CCTACAATTCACTCGGAGATCCT	59.361	47.826	12.86	0.00	33.89	3.24
102	103	5.163195	GGAGATCCTGCCTTATTTAGGTCAA	60.163	44.000	0.00	0.00	46.61	3.18
249	250	6.201806	GCTCTCGCTTTATGTACATTGAATCT	59.798	38.462	14.77	0.00	0.00	2.40
439	444	3.631145	AACTCGTGCGTACAACTTCTA	57.369	42.857	4.09	0.00	0.00	2.10
508	514	2.000447	GACTTAGAACCACGACATGCC	59.000	52.381	0.00	0.00	0.00	4.40
510	516	0.687920	TTAGAACCACGACATGCCCA	59.312	50.000	0.00	0.00	0.00	5.36
511	517	0.036765	TAGAACCACGACATGCCCAC	60.037	55.000	0.00	0.00	0.00	4.61
512	518	2.282180	AACCACGACATGCCCACC	60.282	61.111	0.00	0.00	0.00	4.61
513	519	3.126703	AACCACGACATGCCCACCA	62.127	57.895	0.00	0.00	0.00	4.17
514	520	3.055719	CCACGACATGCCCACCAC	61.056	66.667	0.00	0.00	0.00	4.16
515	521	3.055719	CACGACATGCCCACCACC	61.056	66.667	0.00	0.00	0.00	4.61
516	522	3.565214	ACGACATGCCCACCACCA	61.565	61.111	0.00	0.00	0.00	4.17
517	523	2.282110	CGACATGCCCACCACCAA	60.282	61.111	0.00	0.00	0.00	3.67
518	524	1.900981	CGACATGCCCACCACCAAA	60.901	57.895	0.00	0.00	0.00	3.28
519	525	1.665442	GACATGCCCACCACCAAAC	59.335	57.895	0.00	0.00	0.00	2.93
520	526	1.075674	ACATGCCCACCACCAAACA	60.076	52.632	0.00	0.00	0.00	2.83
521	527	0.471591	ACATGCCCACCACCAAACAT	60.472	50.000	0.00	0.00	0.00	2.71
522	528	1.203112	ACATGCCCACCACCAAACATA	60.203	47.619	0.00	0.00	0.00	2.29
523	529	1.204467	CATGCCCACCACCAAACATAC	59.796	52.381	0.00	0.00	0.00	2.39
524	530	0.186143	TGCCCACCACCAAACATACA	59.814	50.000	0.00	0.00	0.00	2.29
525	531	1.203112	TGCCCACCACCAAACATACAT	60.203	47.619	0.00	0.00	0.00	2.29
526	532	1.476488	GCCCACCACCAAACATACATC	59.524	52.381	0.00	0.00	0.00	3.06
527	533	1.742831	CCCACCACCAAACATACATCG	59.257	52.381	0.00	0.00	0.00	3.84
528	534	1.742831	CCACCACCAAACATACATCGG	59.257	52.381	0.00	0.00	0.00	4.18
529	535	2.616765	CCACCACCAAACATACATCGGA	60.617	50.000	0.00	0.00	0.00	4.55

Showing 1 to 25 of 778 entries

Previous1 2 3 4 5…32Next

Show entries

Search:

Position	MSA Position	Penalty	Sequence	TM	GC	Self any TH	Self end TH	Hairpin	End Stability
102	103	1.677552	GGGTGGTTGAGTGGTCGAT	59.322	57.895	0.00	0.00	0.00	3.59
209	210	2.479730	CGAGAGCATTACAGGTAACGCT	60.480	50.000	11.99	11.99	45.70	5.07
249	250	0.834687	AGCTCCCCTCCGTTACACAA	60.835	55.000	0.00	0.00	0.00	3.33
330	333	6.110033	ACTGGATTATATGCGTGTGTGTTAA	58.890	36.000	0.00	0.00	0.00	2.01
439	444	3.855668	AGAGGCAAGATCCTAGCTATGT	58.144	45.455	0.00	0.00	36.38	2.29
486	492	2.924290	GCATGTCGTGGTTCTAAGTCTC	59.076	50.000	0.00	0.00	0.00	3.36
508	514	1.742831	CCGATGTATGTTTGGTGGTGG	59.257	52.381	0.00	0.00	0.00	4.61
510	516	2.039216	TGTCCGATGTATGTTTGGTGGT	59.961	45.455	0.00	0.00	0.00	4.16
511	517	2.418628	GTGTCCGATGTATGTTTGGTGG	59.581	50.000	0.00	0.00	0.00	4.61
512	518	2.093625	CGTGTCCGATGTATGTTTGGTG	59.906	50.000	0.00	0.00	35.63	4.17
513	519	2.289195	ACGTGTCCGATGTATGTTTGGT	60.289	45.455	0.00	0.00	37.88	3.67
514	520	2.343101	ACGTGTCCGATGTATGTTTGG	58.657	47.619	0.00	0.00	37.88	3.28
515	521	3.250744	AGACGTGTCCGATGTATGTTTG	58.749	45.455	0.00	0.00	37.88	2.93
516	522	3.192844	AGAGACGTGTCCGATGTATGTTT	59.807	43.478	9.40	0.00	37.88	2.83
517	523	2.753452	AGAGACGTGTCCGATGTATGTT	59.247	45.455	9.40	0.00	37.88	2.71
518	524	2.097629	CAGAGACGTGTCCGATGTATGT	59.902	50.000	9.40	0.00	37.88	2.29
519	525	2.097629	ACAGAGACGTGTCCGATGTATG	59.902	50.000	9.40	1.74	37.88	2.39
520	526	2.097629	CACAGAGACGTGTCCGATGTAT	59.902	50.000	9.40	0.00	37.88	2.29
521	527	1.467342	CACAGAGACGTGTCCGATGTA	59.533	52.381	9.40	0.00	37.88	2.29
522	528	0.241213	CACAGAGACGTGTCCGATGT	59.759	55.000	9.40	4.66	37.88	3.06
523	529	3.021541	CACAGAGACGTGTCCGATG	57.978	57.895	9.40	3.99	37.88	3.84
540	546	1.880796	CTTGACGCACGTGGTGACA	60.881	57.895	18.88	8.45	35.23	3.58
541	547	1.590525	TCTTGACGCACGTGGTGAC	60.591	57.895	18.88	5.94	35.23	3.67
542	548	1.590525	GTCTTGACGCACGTGGTGA	60.591	57.895	18.88	4.92	35.23	4.02
543	549	2.927618	CGTCTTGACGCACGTGGTG	61.928	63.158	18.88	7.32	36.51	4.17

Showing 1 to 25 of 777 entries

Previous1 2 3 4 5…32Next

Based at the University of Bristol with support from BBSRC.

AutoCloner maintained by Alex Coulton.