Multiple sequence alignment - TraesCS6D01G158400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6D01G158400 chr6D 100.000 4046 0 0 1 4046 135042854 135038809 0.000000e+00 7472.0
1 TraesCS6D01G158400 chr6D 98.810 3612 33 3 1 3602 134589407 134585796 0.000000e+00 6423.0
2 TraesCS6D01G158400 chr6D 90.112 1962 167 17 1096 3048 134742432 134740489 0.000000e+00 2523.0
3 TraesCS6D01G158400 chr6D 89.792 1969 165 22 1096 3048 134337497 134335549 0.000000e+00 2490.0
4 TraesCS6D01G158400 chr6D 94.694 490 24 1 3559 4046 134585797 134585308 0.000000e+00 760.0
5 TraesCS6D01G158400 chr6D 92.308 78 6 0 1710 1787 33243212 33243135 1.190000e-20 111.0
6 TraesCS6D01G158400 chr6D 95.652 46 2 0 3823 3868 462081379 462081424 1.560000e-09 75.0
7 TraesCS6D01G158400 chr6B 91.810 3309 131 50 76 3312 233675048 233671808 0.000000e+00 4481.0
8 TraesCS6D01G158400 chr6B 90.260 1961 166 16 1096 3048 233088913 233086970 0.000000e+00 2540.0
9 TraesCS6D01G158400 chr6B 94.215 121 6 1 3329 3449 233671822 233671703 2.480000e-42 183.0
10 TraesCS6D01G158400 chr6B 73.041 319 59 18 2441 2756 479079564 479079270 2.000000e-13 87.9
11 TraesCS6D01G158400 chr6A 95.890 2555 65 20 689 3211 176294386 176291840 0.000000e+00 4100.0
12 TraesCS6D01G158400 chr6A 90.846 1573 128 11 1477 3048 175997191 175995634 0.000000e+00 2093.0
13 TraesCS6D01G158400 chr6A 87.726 554 46 15 146 683 176295025 176294478 9.550000e-176 627.0
14 TraesCS6D01G158400 chr6A 93.511 262 15 2 3525 3785 183777985 183778245 4.900000e-104 388.0
15 TraesCS6D01G158400 chr6A 90.968 155 12 2 1096 1249 176002955 176002802 1.470000e-49 207.0
16 TraesCS6D01G158400 chr6A 93.233 133 7 2 3328 3460 176285155 176285025 1.150000e-45 195.0
17 TraesCS6D01G158400 chr6A 88.034 117 11 3 3196 3312 176285253 176285140 7.050000e-28 135.0
18 TraesCS6D01G158400 chr5B 93.258 267 18 0 3525 3791 228385306 228385040 1.050000e-105 394.0
19 TraesCS6D01G158400 chr5B 92.453 53 3 1 3819 3870 490144668 490144616 1.560000e-09 75.0
20 TraesCS6D01G158400 chr3D 93.487 261 17 0 3525 3785 273298751 273299011 4.900000e-104 388.0
21 TraesCS6D01G158400 chr3D 92.509 267 20 0 3525 3791 251145992 251145726 2.280000e-102 383.0
22 TraesCS6D01G158400 chr3D 97.674 43 1 0 631 673 313713541 313713583 1.560000e-09 75.0
23 TraesCS6D01G158400 chr7D 93.103 261 18 0 3525 3785 158534926 158535186 2.280000e-102 383.0
24 TraesCS6D01G158400 chr7D 92.251 271 16 3 3525 3791 272476448 272476179 2.950000e-101 379.0
25 TraesCS6D01G158400 chr7D 92.193 269 19 2 3525 3791 367065066 367065334 2.950000e-101 379.0
26 TraesCS6D01G158400 chr7D 92.164 268 18 2 3525 3791 272404009 272403744 3.820000e-100 375.0
27 TraesCS6D01G158400 chr7D 76.354 554 107 21 1093 1633 30264392 30264934 3.980000e-70 276.0
28 TraesCS6D01G158400 chr7D 93.878 49 3 0 3820 3868 555215174 555215126 1.560000e-09 75.0
29 TraesCS6D01G158400 chr7D 95.349 43 2 0 631 673 26445382 26445340 7.260000e-08 69.4
30 TraesCS6D01G158400 chr4D 92.135 267 21 0 3525 3791 472863939 472863673 1.060000e-100 377.0
31 TraesCS6D01G158400 chr4D 85.030 167 20 3 3881 4046 224431984 224431822 9.000000e-37 165.0
32 TraesCS6D01G158400 chr2D 74.228 939 200 32 2101 3008 565090943 565091870 4.970000e-94 355.0
33 TraesCS6D01G158400 chr2D 76.320 663 129 21 2101 2740 565052904 565053561 3.010000e-86 329.0
34 TraesCS6D01G158400 chr2D 95.918 49 2 0 3821 3869 587784905 587784857 3.350000e-11 80.5
35 TraesCS6D01G158400 chr2A 76.631 659 131 14 2101 2740 705532001 705532655 3.870000e-90 342.0
36 TraesCS6D01G158400 chr2A 92.453 53 4 0 3818 3870 619856918 619856866 4.340000e-10 76.8
37 TraesCS6D01G158400 chr4A 76.259 556 104 18 1093 1633 698171061 698170519 1.850000e-68 270.0
38 TraesCS6D01G158400 chr5D 86.364 176 24 0 3871 4046 510100090 510099915 4.130000e-45 193.0
39 TraesCS6D01G158400 chr1A 85.635 181 26 0 3866 4046 127074396 127074216 1.480000e-44 191.0
40 TraesCS6D01G158400 chr1A 95.833 48 2 0 3821 3868 86653156 86653203 1.210000e-10 78.7
41 TraesCS6D01G158400 chrUn 88.591 149 17 0 3898 4046 289916961 289916813 8.930000e-42 182.0
42 TraesCS6D01G158400 chrUn 88.591 149 17 0 3898 4046 289918214 289918066 8.930000e-42 182.0
43 TraesCS6D01G158400 chrUn 88.591 149 17 0 3898 4046 403544695 403544547 8.930000e-42 182.0
44 TraesCS6D01G158400 chr1B 85.000 180 25 2 3866 4044 651293337 651293159 8.930000e-42 182.0
45 TraesCS6D01G158400 chr1B 93.333 45 3 0 627 671 15379574 15379618 2.610000e-07 67.6
46 TraesCS6D01G158400 chr3B 85.207 169 25 0 3867 4035 416917719 416917551 1.490000e-39 174.0
47 TraesCS6D01G158400 chr3B 90.385 52 4 1 631 682 662015439 662015389 2.610000e-07 67.6
48 TraesCS6D01G158400 chr2B 88.112 143 10 4 2410 2545 138547272 138547130 3.240000e-36 163.0
49 TraesCS6D01G158400 chr5A 94.643 56 1 2 3814 3868 485866042 485865988 7.210000e-13 86.1
50 TraesCS6D01G158400 chr7A 97.561 41 1 0 631 671 306434112 306434152 2.020000e-08 71.3
51 TraesCS6D01G158400 chr7A 91.304 46 4 0 3817 3862 664179510 664179555 3.380000e-06 63.9
52 TraesCS6D01G158400 chr1D 93.182 44 3 0 628 671 72629634 72629677 9.390000e-07 65.8


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6D01G158400 chr6D 135038809 135042854 4045 True 7472.0 7472 100.0000 1 4046 1 chr6D.!!$R4 4045
1 TraesCS6D01G158400 chr6D 134585308 134589407 4099 True 3591.5 6423 96.7520 1 4046 2 chr6D.!!$R5 4045
2 TraesCS6D01G158400 chr6D 134740489 134742432 1943 True 2523.0 2523 90.1120 1096 3048 1 chr6D.!!$R3 1952
3 TraesCS6D01G158400 chr6D 134335549 134337497 1948 True 2490.0 2490 89.7920 1096 3048 1 chr6D.!!$R2 1952
4 TraesCS6D01G158400 chr6B 233086970 233088913 1943 True 2540.0 2540 90.2600 1096 3048 1 chr6B.!!$R1 1952
5 TraesCS6D01G158400 chr6B 233671703 233675048 3345 True 2332.0 4481 93.0125 76 3449 2 chr6B.!!$R3 3373
6 TraesCS6D01G158400 chr6A 176291840 176295025 3185 True 2363.5 4100 91.8080 146 3211 2 chr6A.!!$R4 3065
7 TraesCS6D01G158400 chr6A 175995634 175997191 1557 True 2093.0 2093 90.8460 1477 3048 1 chr6A.!!$R1 1571
8 TraesCS6D01G158400 chr7D 30264392 30264934 542 False 276.0 276 76.3540 1093 1633 1 chr7D.!!$F1 540
9 TraesCS6D01G158400 chr2D 565090943 565091870 927 False 355.0 355 74.2280 2101 3008 1 chr2D.!!$F2 907
10 TraesCS6D01G158400 chr2D 565052904 565053561 657 False 329.0 329 76.3200 2101 2740 1 chr2D.!!$F1 639
11 TraesCS6D01G158400 chr2A 705532001 705532655 654 False 342.0 342 76.6310 2101 2740 1 chr2A.!!$F1 639
12 TraesCS6D01G158400 chr4A 698170519 698171061 542 True 270.0 270 76.2590 1093 1633 1 chr4A.!!$R1 540

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
183 207 1.003839 TCAGTTTCCGCGAAGGCAT 60.004 52.632 8.23 0.0 40.77 4.40 F
1752 1944 1.260538 TGCTCATCCCGCTCAAGAGT 61.261 55.000 0.00 0.0 0.00 3.24 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2151 2343 4.373116 GAGAACCCTGCCGTCGCA 62.373 66.667 0.0 0.00 44.78 5.10 R
3452 3705 2.202623 CACTGCCGCGGTCTCTAC 60.203 66.667 28.7 9.35 0.00 2.59 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
44 45 3.451402 TGGAGGAGCTACACTGAACTA 57.549 47.619 0.00 0.00 0.00 2.24
59 60 5.926542 CACTGAACTAAACTAGCAGTAGCAA 59.073 40.000 0.00 0.00 45.49 3.91
183 207 1.003839 TCAGTTTCCGCGAAGGCAT 60.004 52.632 8.23 0.00 40.77 4.40
331 369 5.048782 AGAGTTGCTTTGAATATTGAACGCA 60.049 36.000 13.43 13.43 0.00 5.24
617 657 8.345565 GGTGTGAATTCTACCATAAAAGCTATG 58.654 37.037 20.62 0.00 34.61 2.23
621 661 8.786898 TGAATTCTACCATAAAAGCTATGCATC 58.213 33.333 0.19 0.00 0.00 3.91
1752 1944 1.260538 TGCTCATCCCGCTCAAGAGT 61.261 55.000 0.00 0.00 0.00 3.24
3022 3244 1.482593 CCTCGGATTACAGCAACTCCT 59.517 52.381 0.00 0.00 0.00 3.69
3629 3924 9.539825 TGTCTAGAAGCATTGATAGAATTTCTC 57.460 33.333 1.27 0.00 28.32 2.87
3728 4023 6.554334 TGGATGAAAGTAAGAAAAGAACCG 57.446 37.500 0.00 0.00 0.00 4.44
3754 4049 9.482627 GCTATGCTTAGAGCTAAAAGAGAATTA 57.517 33.333 10.67 0.00 42.97 1.40
3826 4123 5.279556 GGTTATGTCTGGATCTAGTTAGGGC 60.280 48.000 5.93 0.00 0.00 5.19
3837 4134 2.403252 AGTTAGGGCATCTTCAACGG 57.597 50.000 0.00 0.00 0.00 4.44
3838 4135 1.628846 AGTTAGGGCATCTTCAACGGT 59.371 47.619 0.00 0.00 0.00 4.83
3867 4164 0.958876 AAAACCTCCCGCATTCGTCC 60.959 55.000 0.00 0.00 0.00 4.79
3942 4239 3.236003 GAGAGGGCCACGGTCGTTT 62.236 63.158 6.18 0.00 0.00 3.60
4000 4297 0.252197 GGACCATTCCTTGCCGTACT 59.748 55.000 0.00 0.00 39.13 2.73
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
23 24 2.609747 AGTTCAGTGTAGCTCCTCCAA 58.390 47.619 0.00 0.00 0.00 3.53
44 45 3.748568 GCTGACTTTGCTACTGCTAGTTT 59.251 43.478 0.00 0.00 40.48 2.66
59 60 0.458543 CGTATGCCACTCGCTGACTT 60.459 55.000 0.00 0.00 38.78 3.01
83 84 4.706035 TCTACTACTACTACTCAGCTGCC 58.294 47.826 9.47 0.00 0.00 4.85
127 131 2.038557 CCTCTCTTCTTTCAAACCCGGA 59.961 50.000 0.73 0.00 0.00 5.14
183 207 1.915266 CACCTGTCCCTGAGCTCCA 60.915 63.158 12.15 0.00 0.00 3.86
331 369 1.679680 CATCTTCATTGGCCAATCGCT 59.320 47.619 28.42 5.62 37.74 4.93
441 479 0.462581 AGATGCGCCACCTACATGTG 60.463 55.000 9.11 0.00 35.98 3.21
964 1120 2.631384 TCTTGGAAAGGGGATGAGTGA 58.369 47.619 0.00 0.00 46.24 3.41
2151 2343 4.373116 GAGAACCCTGCCGTCGCA 62.373 66.667 0.00 0.00 44.78 5.10
2707 2920 2.278182 GACAGCAGCTCGAGGAGGAC 62.278 65.000 15.58 0.00 0.00 3.85
3452 3705 2.202623 CACTGCCGCGGTCTCTAC 60.203 66.667 28.70 9.35 0.00 2.59
3566 3861 8.882415 TTACTCAACTTTTCTTCTATCGTTGT 57.118 30.769 0.00 0.00 34.83 3.32
3714 4009 5.547181 AAGCATAGCGGTTCTTTTCTTAC 57.453 39.130 0.00 0.00 0.00 2.34
3719 4014 3.623510 GCTCTAAGCATAGCGGTTCTTTT 59.376 43.478 0.00 0.00 41.89 2.27
3728 4023 7.961325 ATTCTCTTTTAGCTCTAAGCATAGC 57.039 36.000 0.00 0.00 45.56 2.97
3802 4099 5.279556 GCCCTAACTAGATCCAGACATAACC 60.280 48.000 0.00 0.00 0.00 2.85
3867 4164 1.797933 CACGACGCAAGAGGAGACG 60.798 63.158 0.00 0.00 39.88 4.18
3977 4274 1.076705 GGCAAGGAATGGTCCCTCC 60.077 63.158 0.00 0.00 46.30 4.30
4000 4297 4.367023 CGACGGGGAGACGGCAAA 62.367 66.667 0.00 0.00 43.54 3.68


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.