Multiple sequence alignment - TraesCS6D01G158200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6D01G158200 chr6D 100.000 2324 0 0 1 2324 134687921 134690244 0.000000e+00 4292.0
1 TraesCS6D01G158200 chr6D 98.195 2327 34 6 1 2324 134282730 134285051 0.000000e+00 4058.0
2 TraesCS6D01G158200 chr6D 81.006 616 85 16 984 1591 134279456 134280047 5.850000e-126 460.0
3 TraesCS6D01G158200 chr6D 80.366 601 88 14 991 1585 134682681 134683257 1.650000e-116 429.0
4 TraesCS6D01G158200 chr6B 92.637 1589 85 17 714 2291 233023419 233024986 0.000000e+00 2257.0
5 TraesCS6D01G158200 chr6B 80.120 664 97 20 991 1646 233013887 233014523 1.630000e-126 462.0
6 TraesCS6D01G158200 chr6B 100.000 37 0 0 2288 2324 233025319 233025355 4.140000e-08 69.4
7 TraesCS6D01G158200 chr6A 90.122 820 58 11 910 1706 175629275 175630094 0.000000e+00 1044.0
8 TraesCS6D01G158200 chr6A 79.851 670 96 19 984 1638 175621926 175622571 9.790000e-124 453.0
9 TraesCS6D01G158200 chr6A 89.180 305 15 8 1698 2001 175636443 175636730 4.720000e-97 364.0
10 TraesCS6D01G158200 chr6A 87.861 173 14 5 744 912 175629070 175629239 1.820000e-46 196.0
11 TraesCS6D01G158200 chr6A 90.541 148 13 1 2130 2276 175636733 175636880 6.550000e-46 195.0
12 TraesCS6D01G158200 chr2B 87.390 682 66 13 1 672 36900100 36900771 0.000000e+00 765.0
13 TraesCS6D01G158200 chr2B 85.420 679 87 10 5 672 402382359 402381682 0.000000e+00 695.0
14 TraesCS6D01G158200 chr1D 86.888 633 73 10 1 627 271817270 271817898 0.000000e+00 701.0
15 TraesCS6D01G158200 chr1D 85.417 672 83 12 1 660 29470917 29471585 0.000000e+00 684.0
16 TraesCS6D01G158200 chr4D 86.529 631 76 7 2 625 54607277 54607905 0.000000e+00 686.0
17 TraesCS6D01G158200 chr3D 85.131 686 84 14 1 672 464766759 464767440 0.000000e+00 686.0
18 TraesCS6D01G158200 chr5D 84.831 679 92 11 1 669 484400709 484401386 0.000000e+00 673.0
19 TraesCS6D01G158200 chr5D 84.503 684 89 14 1 672 47008370 47009048 0.000000e+00 660.0
20 TraesCS6D01G158200 chr7A 74.004 477 86 31 1023 1481 572875824 572875368 2.390000e-35 159.0
21 TraesCS6D01G158200 chr7B 75.831 331 59 21 1023 1342 533309403 533309083 5.170000e-32 148.0
22 TraesCS6D01G158200 chr7B 73.150 473 85 33 1023 1481 533552571 533552127 5.210000e-27 132.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6D01G158200 chr6D 134687921 134690244 2323 False 4292.0 4292 100.0000 1 2324 1 chr6D.!!$F2 2323
1 TraesCS6D01G158200 chr6D 134279456 134285051 5595 False 2259.0 4058 89.6005 1 2324 2 chr6D.!!$F3 2323
2 TraesCS6D01G158200 chr6D 134682681 134683257 576 False 429.0 429 80.3660 991 1585 1 chr6D.!!$F1 594
3 TraesCS6D01G158200 chr6B 233023419 233025355 1936 False 1163.2 2257 96.3185 714 2324 2 chr6B.!!$F2 1610
4 TraesCS6D01G158200 chr6B 233013887 233014523 636 False 462.0 462 80.1200 991 1646 1 chr6B.!!$F1 655
5 TraesCS6D01G158200 chr6A 175629070 175630094 1024 False 620.0 1044 88.9915 744 1706 2 chr6A.!!$F2 962
6 TraesCS6D01G158200 chr6A 175621926 175622571 645 False 453.0 453 79.8510 984 1638 1 chr6A.!!$F1 654
7 TraesCS6D01G158200 chr2B 36900100 36900771 671 False 765.0 765 87.3900 1 672 1 chr2B.!!$F1 671
8 TraesCS6D01G158200 chr2B 402381682 402382359 677 True 695.0 695 85.4200 5 672 1 chr2B.!!$R1 667
9 TraesCS6D01G158200 chr1D 271817270 271817898 628 False 701.0 701 86.8880 1 627 1 chr1D.!!$F2 626
10 TraesCS6D01G158200 chr1D 29470917 29471585 668 False 684.0 684 85.4170 1 660 1 chr1D.!!$F1 659
11 TraesCS6D01G158200 chr4D 54607277 54607905 628 False 686.0 686 86.5290 2 625 1 chr4D.!!$F1 623
12 TraesCS6D01G158200 chr3D 464766759 464767440 681 False 686.0 686 85.1310 1 672 1 chr3D.!!$F1 671
13 TraesCS6D01G158200 chr5D 484400709 484401386 677 False 673.0 673 84.8310 1 669 1 chr5D.!!$F2 668
14 TraesCS6D01G158200 chr5D 47008370 47009048 678 False 660.0 660 84.5030 1 672 1 chr5D.!!$F1 671

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
383 3661 0.555769 TGAAAACCCAAGGTCTGGCT 59.444 50.000 0.0 0.0 44.90 4.75 F
435 3715 4.023193 GTCGAGTCATTGTTTTGGGAACAT 60.023 41.667 0.0 0.0 42.32 2.71 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1240 4580 0.317479 ACGAAGTATATCTGCCCCGC 59.683 55.000 0.0 0.0 41.94 6.13 R
2019 5383 2.358125 CATCGCCGGTTCACACCA 60.358 61.111 1.9 0.0 44.53 4.17 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
74 3349 3.772025 TGTTTTTGTTGACACCTTGGGAT 59.228 39.130 0.00 0.0 0.00 3.85
88 3363 3.355378 CTTGGGATATGTCTGCACCAAA 58.645 45.455 3.17 0.0 37.51 3.28
102 3377 3.393941 TGCACCAAAATTTCCAAGGGATT 59.606 39.130 0.00 0.0 0.00 3.01
383 3661 0.555769 TGAAAACCCAAGGTCTGGCT 59.444 50.000 0.00 0.0 44.90 4.75
435 3715 4.023193 GTCGAGTCATTGTTTTGGGAACAT 60.023 41.667 0.00 0.0 42.32 2.71
664 3954 9.859427 CTTGAATGTTTTTAGGCATCTTATTGA 57.141 29.630 0.00 0.0 0.00 2.57
2019 5383 2.995872 GCGCCTTGGAGTCTCGACT 61.996 63.158 0.00 0.0 45.84 4.18
2193 5557 2.613739 TACTGGACAGCGATGCGAGC 62.614 60.000 0.00 0.0 0.00 5.03
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
74 3349 5.279406 CCTTGGAAATTTTGGTGCAGACATA 60.279 40.000 0.00 0.00 0.00 2.29
88 3363 4.161001 GCATCTGTCAATCCCTTGGAAATT 59.839 41.667 0.00 0.00 34.34 1.82
102 3377 0.462581 GGCATTCTCCGCATCTGTCA 60.463 55.000 0.00 0.00 0.00 3.58
383 3661 5.300539 TCACTGCTAGGCACAAACAATAAAA 59.699 36.000 0.00 0.00 33.79 1.52
435 3715 3.943671 TTTCACCCTGAAGAAAGACCA 57.056 42.857 0.00 0.00 37.70 4.02
1040 4380 4.074526 GTGGCTGCTGCGAGAGGA 62.075 66.667 9.65 0.00 40.82 3.71
1240 4580 0.317479 ACGAAGTATATCTGCCCCGC 59.683 55.000 0.00 0.00 41.94 6.13
1321 4661 4.257510 GATCGCCGAGCTCGCTCA 62.258 66.667 30.49 15.49 42.86 4.26
2019 5383 2.358125 CATCGCCGGTTCACACCA 60.358 61.111 1.90 0.00 44.53 4.17


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.