Multiple sequence alignment - TraesCS6D01G151100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6D01G151100 chr6D 100.000 2255 0 0 1 2255 124534303 124536557 0 4165
1 TraesCS6D01G151100 chr6D 99.303 1004 7 0 1252 2255 458963670 458962667 0 1816
2 TraesCS6D01G151100 chrUn 99.202 2255 18 0 1 2255 189409267 189411521 0 4065
3 TraesCS6D01G151100 chrUn 99.092 1873 17 0 1 1873 251407329 251405457 0 3365
4 TraesCS6D01G151100 chrUn 99.104 1004 9 0 1252 2255 86477659 86476656 0 1805
5 TraesCS6D01G151100 chr7D 98.892 2257 22 2 1 2255 626681055 626678800 0 4026
6 TraesCS6D01G151100 chr7D 99.443 1617 9 0 639 2255 382000221 381998605 0 2937
7 TraesCS6D01G151100 chr1D 99.046 1258 11 1 1 1258 141314951 141313695 0 2255
8 TraesCS6D01G151100 chr3A 98.728 1258 16 0 1 1258 633109438 633110695 0 2235
9 TraesCS6D01G151100 chr1B 98.728 1258 16 0 1 1258 668806977 668805720 0 2235
10 TraesCS6D01G151100 chr1B 98.728 1258 16 0 1 1258 672477345 672478602 0 2235
11 TraesCS6D01G151100 chr7A 98.649 1258 17 0 1 1258 60150103 60148846 0 2230
12 TraesCS6D01G151100 chr7A 98.904 1004 11 0 1252 2255 60243430 60244433 0 1794
13 TraesCS6D01G151100 chr7B 98.570 1259 17 1 1 1258 644465627 644466885 0 2224
14 TraesCS6D01G151100 chr7B 98.904 1004 11 0 1252 2255 743004783 743003780 0 1794
15 TraesCS6D01G151100 chr1A 99.402 1004 6 0 1252 2255 22566051 22565048 0 1821


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6D01G151100 chr6D 124534303 124536557 2254 False 4165 4165 100.000 1 2255 1 chr6D.!!$F1 2254
1 TraesCS6D01G151100 chr6D 458962667 458963670 1003 True 1816 1816 99.303 1252 2255 1 chr6D.!!$R1 1003
2 TraesCS6D01G151100 chrUn 189409267 189411521 2254 False 4065 4065 99.202 1 2255 1 chrUn.!!$F1 2254
3 TraesCS6D01G151100 chrUn 251405457 251407329 1872 True 3365 3365 99.092 1 1873 1 chrUn.!!$R2 1872
4 TraesCS6D01G151100 chrUn 86476656 86477659 1003 True 1805 1805 99.104 1252 2255 1 chrUn.!!$R1 1003
5 TraesCS6D01G151100 chr7D 626678800 626681055 2255 True 4026 4026 98.892 1 2255 1 chr7D.!!$R2 2254
6 TraesCS6D01G151100 chr7D 381998605 382000221 1616 True 2937 2937 99.443 639 2255 1 chr7D.!!$R1 1616
7 TraesCS6D01G151100 chr1D 141313695 141314951 1256 True 2255 2255 99.046 1 1258 1 chr1D.!!$R1 1257
8 TraesCS6D01G151100 chr3A 633109438 633110695 1257 False 2235 2235 98.728 1 1258 1 chr3A.!!$F1 1257
9 TraesCS6D01G151100 chr1B 668805720 668806977 1257 True 2235 2235 98.728 1 1258 1 chr1B.!!$R1 1257
10 TraesCS6D01G151100 chr1B 672477345 672478602 1257 False 2235 2235 98.728 1 1258 1 chr1B.!!$F1 1257
11 TraesCS6D01G151100 chr7A 60148846 60150103 1257 True 2230 2230 98.649 1 1258 1 chr7A.!!$R1 1257
12 TraesCS6D01G151100 chr7A 60243430 60244433 1003 False 1794 1794 98.904 1252 2255 1 chr7A.!!$F1 1003
13 TraesCS6D01G151100 chr7B 644465627 644466885 1258 False 2224 2224 98.570 1 1258 1 chr7B.!!$F1 1257
14 TraesCS6D01G151100 chr7B 743003780 743004783 1003 True 1794 1794 98.904 1252 2255 1 chr7B.!!$R1 1003
15 TraesCS6D01G151100 chr1A 22565048 22566051 1003 True 1821 1821 99.402 1252 2255 1 chr1A.!!$R1 1003

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
523 524 1.081892 GAGCTTGCTTCAATGCTCGA 58.918 50.0 11.91 0.0 36.13 4.04 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2170 2175 0.537653 TGGACGATCCCAATGCGTTA 59.462 50.0 0.0 0.0 38.51 3.18 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
23 24 6.465439 TTACAACTTCTCTGTCTCAACTCA 57.535 37.500 0.00 0.0 0.00 3.41
226 227 6.577427 CCGTCAATTGTAAAAAGTAGTTGAGC 59.423 38.462 5.13 0.0 0.00 4.26
386 387 4.922206 TGGCTTTTTCATGTACCAGATCT 58.078 39.130 0.00 0.0 0.00 2.75
429 430 8.316214 AGCAAAAATGGACATACAATCAAAGAT 58.684 29.630 0.00 0.0 0.00 2.40
523 524 1.081892 GAGCTTGCTTCAATGCTCGA 58.918 50.000 11.91 0.0 36.13 4.04
913 916 2.409378 CGCTTGTGTGAATTTCATTGCC 59.591 45.455 1.78 0.0 0.00 4.52
1036 1039 4.248058 CATCCAAAAAGTCAAAGATGGCC 58.752 43.478 0.00 0.0 0.00 5.36
1859 1864 2.517402 CGCTACCTCGGGAGCTCT 60.517 66.667 17.61 0.0 36.50 4.09
2170 2175 1.520666 CGGTATTGCGAAGGAGGGT 59.479 57.895 0.00 0.0 0.00 4.34
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
3 4 4.689812 CCATGAGTTGAGACAGAGAAGTTG 59.310 45.833 0.00 0.00 0.00 3.16
202 203 6.577427 GGCTCAACTACTTTTTACAATTGACG 59.423 38.462 13.59 0.00 0.00 4.35
226 227 3.573772 TTGCTCCTGCGAGACACGG 62.574 63.158 0.00 0.00 43.34 4.94
386 387 0.321919 GCTTGATGTCTGGCTCACCA 60.322 55.000 0.00 0.00 46.51 4.17
429 430 6.620678 GTCATTGCAAATAACTGCTCCTTAA 58.379 36.000 1.71 0.00 43.07 1.85
523 524 5.046520 ACTGCTCTTACTTTCTACCGGAATT 60.047 40.000 9.46 0.00 33.53 2.17
1036 1039 6.870965 AGAGAGCATAATAAGTAAATGCCGAG 59.129 38.462 3.08 0.00 45.66 4.63
1859 1864 2.492881 TGAAGCGAGTATACCGTTTCCA 59.507 45.455 25.26 17.04 43.37 3.53
2170 2175 0.537653 TGGACGATCCCAATGCGTTA 59.462 50.000 0.00 0.00 38.51 3.18


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.