Multiple sequence alignment - TraesCS6D01G151000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6D01G151000 chr6D 100.000 2232 0 0 1 2232 124519196 124521427 0.000000e+00 4122
1 TraesCS6D01G151000 chr6D 98.568 2235 27 3 1 2232 458899856 458902088 0.000000e+00 3945
2 TraesCS6D01G151000 chr7D 99.328 2232 13 2 1 2232 382051753 382053982 0.000000e+00 4037
3 TraesCS6D01G151000 chr7D 99.238 2232 15 2 1 2232 381925675 381927904 0.000000e+00 4026
4 TraesCS6D01G151000 chr7D 99.195 2237 12 2 1 2232 381972096 381969861 0.000000e+00 4026
5 TraesCS6D01G151000 chr7D 98.880 2233 16 7 1 2232 203501673 203503897 0.000000e+00 3976
6 TraesCS6D01G151000 chr7D 96.721 61 1 1 2173 2232 626693989 626693929 1.410000e-17 100
7 TraesCS6D01G151000 chr1D 98.522 2232 31 2 1 2232 269408474 269410703 0.000000e+00 3938
8 TraesCS6D01G151000 chr7B 98.950 2191 16 3 1 2190 742991119 742993303 0.000000e+00 3912
9 TraesCS6D01G151000 chr7B 98.813 2191 19 3 1 2190 716877107 716874923 0.000000e+00 3895
10 TraesCS6D01G151000 chr7A 98.904 2190 18 2 1 2190 60280987 60283170 0.000000e+00 3906
11 TraesCS6D01G151000 chr3A 98.333 60 1 0 2173 2232 227648530 227648589 3.030000e-19 106
12 TraesCS6D01G151000 chr6B 96.721 61 1 1 2173 2232 388152989 388152929 1.410000e-17 100


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6D01G151000 chr6D 124519196 124521427 2231 False 4122 4122 100.000 1 2232 1 chr6D.!!$F1 2231
1 TraesCS6D01G151000 chr6D 458899856 458902088 2232 False 3945 3945 98.568 1 2232 1 chr6D.!!$F2 2231
2 TraesCS6D01G151000 chr7D 382051753 382053982 2229 False 4037 4037 99.328 1 2232 1 chr7D.!!$F3 2231
3 TraesCS6D01G151000 chr7D 381925675 381927904 2229 False 4026 4026 99.238 1 2232 1 chr7D.!!$F2 2231
4 TraesCS6D01G151000 chr7D 381969861 381972096 2235 True 4026 4026 99.195 1 2232 1 chr7D.!!$R1 2231
5 TraesCS6D01G151000 chr7D 203501673 203503897 2224 False 3976 3976 98.880 1 2232 1 chr7D.!!$F1 2231
6 TraesCS6D01G151000 chr1D 269408474 269410703 2229 False 3938 3938 98.522 1 2232 1 chr1D.!!$F1 2231
7 TraesCS6D01G151000 chr7B 742991119 742993303 2184 False 3912 3912 98.950 1 2190 1 chr7B.!!$F1 2189
8 TraesCS6D01G151000 chr7B 716874923 716877107 2184 True 3895 3895 98.813 1 2190 1 chr7B.!!$R1 2189
9 TraesCS6D01G151000 chr7A 60280987 60283170 2183 False 3906 3906 98.904 1 2190 1 chr7A.!!$F1 2189

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
278 279 4.462483 GTGATACAGCCCTTTCCATTTTCA 59.538 41.667 0.0 0.0 0.0 2.69 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1327 1337 6.58799 GTCACGATCCATTGGTTCATATAGAG 59.412 42.308 13.0 0.0 0.0 2.43 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
278 279 4.462483 GTGATACAGCCCTTTCCATTTTCA 59.538 41.667 0.00 0.00 0.0 2.69
1327 1337 5.871396 TTTGATAGACCTAGGACATGGAC 57.129 43.478 17.98 1.76 0.0 4.02
1845 1856 1.404035 CATCACGTGTCCAGATACCGA 59.596 52.381 16.51 0.00 0.0 4.69
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
278 279 1.165270 CTTCGCCGTTCTTTCCCAAT 58.835 50.000 0.00 0.0 0.00 3.16
476 477 7.584122 ATTCAGATATCTTTTGCAATCAGCT 57.416 32.000 1.33 0.0 45.94 4.24
1327 1337 6.587990 GTCACGATCCATTGGTTCATATAGAG 59.412 42.308 13.00 0.0 0.00 2.43


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.