Multiple sequence alignment - TraesCS6D01G150900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6D01G150900 chr6D 100.000 2594 0 0 1 2594 124517489 124520082 0 4791
1 TraesCS6D01G150900 chr5A 99.422 2595 14 1 1 2594 19248877 19246283 0 4708
2 TraesCS6D01G150900 chr7D 99.345 2594 17 0 1 2594 381923968 381926561 0 4697
3 TraesCS6D01G150900 chr7D 99.268 2594 19 0 1 2594 203499966 203502559 0 4686
4 TraesCS6D01G150900 chr7D 99.268 2595 18 1 1 2594 382050045 382052639 0 4686
5 TraesCS6D01G150900 chr7D 99.077 2599 16 2 1 2594 381973800 381971205 0 4660
6 TraesCS6D01G150900 chr7B 98.921 2594 22 2 1 2594 716878813 716876226 0 4630
7 TraesCS6D01G150900 chr7B 98.805 2595 24 3 1 2594 742989413 742992001 0 4614
8 TraesCS6D01G150900 chr3A 98.034 2594 50 1 1 2594 725796716 725799308 0 4506
9 TraesCS6D01G150900 chr3B 97.303 2595 61 4 1 2594 797592967 797590381 0 4396


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6D01G150900 chr6D 124517489 124520082 2593 False 4791 4791 100.000 1 2594 1 chr6D.!!$F1 2593
1 TraesCS6D01G150900 chr5A 19246283 19248877 2594 True 4708 4708 99.422 1 2594 1 chr5A.!!$R1 2593
2 TraesCS6D01G150900 chr7D 381923968 381926561 2593 False 4697 4697 99.345 1 2594 1 chr7D.!!$F2 2593
3 TraesCS6D01G150900 chr7D 203499966 203502559 2593 False 4686 4686 99.268 1 2594 1 chr7D.!!$F1 2593
4 TraesCS6D01G150900 chr7D 382050045 382052639 2594 False 4686 4686 99.268 1 2594 1 chr7D.!!$F3 2593
5 TraesCS6D01G150900 chr7D 381971205 381973800 2595 True 4660 4660 99.077 1 2594 1 chr7D.!!$R1 2593
6 TraesCS6D01G150900 chr7B 716876226 716878813 2587 True 4630 4630 98.921 1 2594 1 chr7B.!!$R1 2593
7 TraesCS6D01G150900 chr7B 742989413 742992001 2588 False 4614 4614 98.805 1 2594 1 chr7B.!!$F1 2593
8 TraesCS6D01G150900 chr3A 725796716 725799308 2592 False 4506 4506 98.034 1 2594 1 chr3A.!!$F1 2593
9 TraesCS6D01G150900 chr3B 797590381 797592967 2586 True 4396 4396 97.303 1 2594 1 chr3B.!!$R1 2593

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
961 966 1.228429 CGAGCCCCAAGAAAACCCA 60.228 57.895 0.0 0.0 0.0 4.51 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1985 1990 1.16527 CTTCGCCGTTCTTTCCCAAT 58.835 50.0 0.0 0.0 0.0 3.16 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
66 67 1.896220 TCGTTTCTGCTTCTGCCAAT 58.104 45.000 0.0 0.0 38.71 3.16
961 966 1.228429 CGAGCCCCAAGAAAACCCA 60.228 57.895 0.0 0.0 0.00 4.51
1249 1254 9.052759 GTTCGATTGGACATGTAGGTTATATTT 57.947 33.333 0.0 0.0 0.00 1.40
1602 1607 3.073274 AGGTTGCCATGAGTAAGGTTC 57.927 47.619 0.0 0.0 0.00 3.62
1985 1990 4.462483 GTGATACAGCCCTTTCCATTTTCA 59.538 41.667 0.0 0.0 0.00 2.69
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
66 67 4.319133 GGCGAGGCCTTCATTTCA 57.681 55.556 6.77 0.0 46.69 2.69
961 966 0.336737 ATTGAGTCCGAGGGAGAGGT 59.663 55.000 0.00 0.0 29.39 3.85
1038 1043 4.397417 GCAATAGAAAGGAATGCTGTCACT 59.603 41.667 0.00 0.0 34.29 3.41
1249 1254 4.385825 GTTCCACATGAGAAACCAGTACA 58.614 43.478 0.00 0.0 0.00 2.90
1553 1558 2.481795 GCCCAACGACCTATAACGCTAA 60.482 50.000 0.00 0.0 0.00 3.09
1985 1990 1.165270 CTTCGCCGTTCTTTCCCAAT 58.835 50.000 0.00 0.0 0.00 3.16
2183 2188 7.584122 ATTCAGATATCTTTTGCAATCAGCT 57.416 32.000 1.33 0.0 45.94 4.24


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.